Pevnost - Draci

Tato diskuze byla převedena z bývalého diskuzního fóra na www.pevnost.cz. O původní fórum nebylo pečováno a zanášelo se spamem, tak jsem se rozhodl ho zachránit. Zde si můžete celou diskuzi přečíst, tak jak byla postupně vytvářena.
Pokud má někdo nějaké dotazy nebo připomínky, nechť se mi ozve na email flaiming@draci.info.

Draci I | Draci II | Draci IIII | Draci IV

Vyhledávání:


argonantus25.2.2003 (9:37)
Ale, co pořád elfové a trpaslíci - DRAKY to chce!!
Redakce zkusila tohle téma v únorové Pevnosti. Bylo to pěkné (zejména Divousův heraldický článek), nicméně myslím, že toho bylo dost málo. Jedna povídka... básnička... draci ohně, vody a nebes... dračí lodě... Arawathův článek...
ale přijde mi to trochu málo, Antone Pavloviči! Co drak jakožto alchymický symbol? Jak to vlastně bylo se svatým Jiřím (a Michaelem či Marcelem?) Co antičtí draci? A co drakodlaci? Co to hlavní - jak je to s draky doopravdy?

Takže sem s draky; my těm hnusným "ahaves" ukážeme!
Draco25.2.2003 (9:47)
Viiiiiiiiiic draku, viiiiiiiiiiiiiiiiiiiiiiiic draku
Wothan25.2.2003 (10:00)
Bóže, co je to za zvěrstvo taký Drakodlak?
argonantus25.2.2003 (10:18)
Já mám dojem, že drakodlaka vynalezl jaksi mimochodem Tolkien. V Hobitovi je někde zmínka, že "raději bych šel bojovat s drakodlaky na poslední poušti". Nic víc.
Potom se toho chopila komerce, totiž Altar, a zavedla Drakodlaka jako jakousi ultimátní potvoru.
Nezávisle na tom měli odedávna někteří draci schopnost měnit se v lidi (viz například Ciruelova kniha; také Sapkowski a jeho zlatý drak). Jsou to ovšem nikoli lidští "dlaci", ale je to obráceně - draci, co předstírají, že jsou lidé.
Celá ta myšlenka je čímsi fascinující, a určitě o ní ještě uslyšíme.
Na druhé straně předpokládám, že pro Staré draky z doby před Pádem musí být jakákoli myšlenka na něco podobného odporná; lidé jsou pro ně potomky krys. Měnit se v člověka pro ně musí být stejně lákavé, jako pro nás měnit se v hada. Je v tom něco úchylného.
Wothan25.2.2003 (11:25)
Aha. Mimochodem máme na webu zajímavý článek o dracích od kamarádky restaurátorky - původně to byla jen příloha k restaurátorské zprávě, ale vydalo to na docela slušný článek pro náš web: http://www.wothanburg.cz/drak.html
Argonantus25.2.2003 (12:21)
Díky, Wothane - ten odkaz stojí docela zato.

Nikdo zatím nezmínil tu alchymickou rovinu věci, která je dost důležitá. Obraz probodeného draka (ať Svatým Jiřím, nebo někým jiným) je dost důležitým obrazem té snad vůbec nejtajnější práce; není náhoda, že provází lidské dějiny právě v těch místech, kde nějací alchymisté byli (Řecko, Byzanc, křesťanská Evropa - zejména Francie - od poloviny 12. století.)

Krom toho černý drak je zároveň Merkurius.

A pak je tu ještě stejně "profláknutý" obraz zápasu Lva a Draka (pověst o našem Bruncvíkovi, například), zřejmě z téže doby.

Souvislost heraldických barev a alchymie je vůbec hluboká; není náhoda, že se objevily na naší scéně skoro zároveň (polovina 12. století), právě jako tehdejší móda mariánského kultu (viz Lilith, na kterou jsme narazili v hermetismu).
darkelf25.2.2003 (13:53)
Drakodlaci je jenom další výplod pomatené lidsské namyšlenossti o dokonalossti jejich genové výbavy a nekonečnému křížení ss osstatními druhy!
Argonantus25.2.2003 (13:58)
Určitě. Pokud tu věc nevymysleli draci - heretici.
Nebo dokonce elfové, ty jsou pro každou vymyšlenost.
darkelf25.2.2003 (14:04)
Wow, odpověď rychlosstí myšlenky! Elfové mají cit pro realitu, takže habaďůra ss nedissciplinovaným oplodňováním dračích vajec Humány je poněkud iracionální!
...jinak Drak Heretik? Nejssou ssnad všichni draci ve ssvé podsstatě neutrální?
Argonantus25.2.2003 (14:11)
Já jsem přesvědčen, že ti, které nazývám Staří nebo Původní, ti byli neutrální určitě. Byli tu dřív, než cokoli jiného, lidmi počínaje, přes elfy, tpaslíky a možná i Dobro a Zlo. Když myslíš v milionech let, nějaké Dobro a Zlo se tam nevejde.
Jenomže po Pádu se to muselo změnit; právě v důsledku setkávání s jinými rasami. Ti Původní na to kašlali - ale určitě s někteří nechali zlákat.
Jak jinak by mohli draci přijít k zájmu o zlato, nebo o mladé panny, nebo o další pitominky? To už je jasná hereze; cesta od pravého a vznešeného dractví. Čertví, jestli pak někoho nenapadla ta ptákovina s drakodlakem.
darkelf25.2.2003 (14:18)
Dractví, to zní moc nadnešeně. Draci jssou ssice sstaří, ale nejssou nejsstarší. Díky ním ssnad ssvět pochopí, že kdyssi dávno boj dobra sse zlem neexisstoval. Možná sse ssnaží obnovit ssvůj původní sstarý ssvět a tak kradou zlato, které tak ovlivňuje sspropadenou Humánsskou rassu (Trpašíky nepočítaje). Panny, kdy by žral panny? I když, možná je to ssymbolika toho, že už nesstojí o další šíření lidsské rassy (ssnísst žensskou dřív, než začne rodit). A i přessto, to co lidé považují za chování zla, je pouhé chránění teritoria a tvorů, kteří na něm žijí před lidmi.
Argonantus25.2.2003 (14:31)
A co je ještě starší, než draci? Nějak mne nenapadá mnoho věcí, které by stály za řeč... hvězdy? Hory? Nějakej vodní malej potvor? Nenapadá mne nic, co bych si troufl nazvat Bytostí...
darkelf25.2.2003 (14:37)
Nelze tyto sstarší nazývat bytosstmi, protože oni nepocházejí z našeho ssvěta (a kdo vlasstně pochází). Draci jssou ještěři a zárovaň magičtí tvorové, mussel být někdo, kdo těm studenokrevným ještěrkám znalossti o magii předal....ssnad nižší tvorové jeho druhu...Lizardi, Illitidé, Beholdeři, ssnad i démoni!
Argonantus25.2.2003 (14:52)
No já nevím... mne učili (draci), že na to oni (draci) přišli sami.

Nějací lizardi...! No tohle! To má byť čo?
A co se týče démonů, sice nepochybuji, že ovládají magii, ale nějak mne nenapaá, proč by ji někoho měli učit.... a jsou vůbec démoni starší, než draci? Není to zas nějaký výtvor něčího psychična (a nemusí to být jen lidské psychično... takoví elfové s tím také dost otravují...)

Ti beholdeři... tož, to je těžké - nejsou oni nějaké chobotnicovaté tentononc? Pak by MOHLI být starší... Ale copak může vymyslet chobotnice něco opravdu světaborného?

Tady narážíš na meze mých znalostí. Jsem sice starý, ale jsem jenom Argonantus. Já to těžko zkontroluju, jak to vlastně bylo... a hádej se s drakem a vysvětluj mu, že vlastně nic nevymyslel...
Wothan25.2.2003 (15:04)
Argonaut: co třeba bakterie? :-)
Argonantus25.2.2003 (15:11)
Wothane, to myslíš vážně? Magie bakterií?
Wothan25.2.2003 (15:38)
Jen ty se špičatou čepicí...
anonym25.2.2003 (15:45)
Mám dotaz na kohokoli, kdo bude nít čas a chuť odpovědět: Jakto, že se draci vyskytují ve spoustě civilizací, které se nikdy nepotaly a nevěděly o sobě? Neznaly se, tak jak...
darkelf25.2.2003 (16:22)
Argonantus: Ty neznáš Lizardy, ještěrčí národ. (Drak je plaz a hodně vyvinutý řekl bych, tak nevidím důvod, proč by zaosstalejší rassa nemohla býti sstarší. Nehledě na to, že mají sspolečný 80% a více genetického kódu). A pokud ještě z toho vyloučíš extrémní potenci Humánů a vzniku polohumanoidů, je tahle alternativa reálná. Bohužel neznají tak dokonale ssvoji hisstorii a to je odssuzuje!
Netvrdím, že někdo mussel učit pradraky (jisstě tupý přerosstlý ještěrky) magii, co když ji okoukali (třeba po dobu mnoho tissíc let). A ssnad i přess jejich vynikající paměť (draci ji mají opravdu dobrou), byli znalossti předávány z pokolení na pokolení. Proč by to nemohli býti démoni, stejně ssilní, sstejně moudří a dokonalí.
Beholdeři jssou tvorové sstejně ssilní jako draci. Pokud sse ti povede zabít Beholdera, tak je to pouze mladej kuss. A magie je ssoučásstí jejich těla, což sse drakům zatím ještě moc nepodařilo. Nepodceňuj chobotnice, zatím jssou pod dozorem, ale....
....a z drakem sse hádat nebudu, i kldyž mám rád ssmrt, chtěl bych k ní přijít v jiných, méně bolesstivých okolnosstech.
darkelf25.2.2003 (16:23)
Bakterie nám vyčarovali kysslím, mysslím? Takže do určité míry jssou ve ssvé podsstatě kouzelníci.
darkelf25.2.2003 (16:26)
Anonym: No nevím co ti řeknou osstatní, ale assi to bude tím, že kdyssi dávno na konci prvohor a v druhohorách žili tvorové (a to i v Antarktidě), kteří ssvoji kosstrou velmi blízce připomínali Draky. A jelikož jejich kossti sse nerozpusstily díky kysselým dešťům, tak je našli, zpanikařili a utekli!
Fanda25.2.2003 (20:08)
Ano, toť otázka - proč jen ti draci jsou všude... co já vím, tak minimálně v Evropě, Asii a Americe?
Když by se na to člověk kouknul podrobněji, tak zjistí, že rozdíly mezi draky jednotlivých kontinentů jsou velké co do vlastností a už menší co do vzhledu (čemuž se není co divit - přibyl-li cestovatel do kraje, kde měli nějakého tvora, který vypadal jako velká ještěrka, přeložil to jako "drak", anšto drak je velká ještěrka).
Otázkou zůstává, proč ale hergot velká ještěrka (univerzál to rozhodně není - tak např. v Africe mají velké modré mořské lvy). Z části je to, jak uvádí Darkelf výše - ostatně jakýkoli nález velké lebky byl v Evropě přisuzován drakům (a to i lebkám jeskynních medvědů), tedy, pokud to nebyla lebka slona - to pak byl Kyklop. Zde to ale vypadá, že to nakrásně mohlo být naopak - tedy nejdříve víra v draka a pak až dodatečné důkazy z lebek. Co já vím, třeba to má, min. v Evropě, souvislost s hadem, kterého se přece jen dost lidí bojí (když už jsem u toho, víte, že velmi nepříjemný zvuk, který vydává křída vrzající po tabuli je jako na potvoru velmi podobný opičímu varovnému signálu, když uvidí hada?) a pokud vím, ani křesťanství se k němu nestaví nejlépe. Jenže draci tu byli už za antického Řecka.
Možná to vzniklo z toho, že lidi opravdu mají strach z hadů a krokodýlů a co je horšího než had a krokodýl? Velký had nebo krokodýl n.b. s více hlavama (což tedy byla u Řeků Hydra - že tento pochod nemusí být zcestný by mohlo naznačovat zvíře z trochu jiného ranku - Kerberos). Teď mě tak napadá, že nějak si nevybavuji draka u starých Egypťanů - jen velkého hada, a taktéž u Babylóňanů (tam měli snad jen gryfa...)
A nesmíme zapomínat i na takové ty mizivé možnosti, že někde snad přežili dinosauři déle, než by se mnohý paleontolog nadál (např. mekeke mbembe, či jak se to).
Na původ draků v Evropě by bylo asi nejlepší zeptat se nějakého archeologa / etnografa. Já si už víc z prstu nevycucám.
argonantus25.2.2003 (21:52)
Darkelf: Už si vzpomínám, co jsou lizardmani - je to takové to v Might and magic, a za moc to nestojí. Ne, z toho se drak rozhodně vyvinout nemohl - morfologicky je drak od počátku létající tvor (a stará vyobrazení, která ho vidí jako hada, jsou taky vedle - je to zmotání staré Egyptské tradice hadů s draky. To víte, lidé.) Had prostě nemůže technicky lítat - má na to úplně pitomý tvar těla.

Můj osobní kandidát na předchůdce draků je potvora, kterou lidé nazývají Dimorphodon macronix (nebo něco dost podobného, co se ještě nenašlo). Existovalo to před 180.000.000 lety a vypadá to dost úžasně. Velikost kolem tří metrů (při evoluci se tvor zvětšuje, takže za sto milionů let vývoje mohl být dost ohromný), žil v bažinách a pohyboval se klouzavým letem v místech, kde je dnes Británie a Benelux (i když svět vypadal naprosto jinak). Jeho potomci mohli být opravdu leckde (Pangea se ještě nerozpadla), takže to je současně odpovědí na otázku, proč jsou všude možně po světě.

Beholdeři jsou zřejmě pěkná ujetost (také si na ně vzpomínám v Might and Magic, byli pěkně vytuhlí); možná jsou dost staří; ale nenapadá mne, proč by jejich magie měla jakkoli souviset s tou dračí.

Fanda a Anonym: Vysvětlování mýtu draka pomocí krokodýlů (či varanů a vůbec hadů) neobstojí, protože drak létá a tím pádem vypadá úplně jinak od samého počátku (tvar těla připomíná dinosaura či ptáka; stojí na zadních). Drak také v žádném případě nemohl mít čtyři nohy, když měl současně křídla (šestikončetinový tvor je ptákovina). Podle mne měl drápy na křídlech, právě jako ten můj dimorphodon, a současné mládě hoacina; do těch drápů mohl kořist klidně uchopit. Už mnohokrát věda nějaké zvíře popírala, aby se pak ukázalo, že existuje (nebo existovalo v době minulé - zda draci vyhynuli, to je další problém).
Argonantus26.2.2003 (9:18)
Fanda a Anonym: Ta kniha, kterou má Fanda asi na mysli, je o kryptozoologii napsal ji Jaroslav Mareš - odtud je údajný existující sauropod, jménem Mokele mbembe. Mnohem zajímavější pro naše účely je pojednání o tvorovi, jménem Kongamato, který možná (?) reálně a vědecky existuje v pralese Džiundu, to je v místech, kde se na mapě setkávají hranice Zairu, Angoly a Zambie. Takové kongamato vypadá jako drak úplně nejvíc ze všeho, o čem byla řeč - létavý tvor, dva metry rozpětí křídel, velká hlava a dost hrozné zuby. Loví opice a občas i lidi, když na ně narazí (málokdy). Černoši se ho příšerně bojí. Bílí na něj narazili už ve dvacátých letech (nějaký Angličan a francouzský markýz; pár dalších badatelů, včetně Mareše okolo r. 1970.)

Kongamato a Dimorphodon ovšem nevysvělují zcela prapůvodní Anonymovu otázku, která je podstatná, protože se vyskytují buď hrozně dávno v čase, nebo v hrozně malém prostoru. Jak to, že každá civilizace, jakmile sleze ze stromů, vymyslí draka? A jak to, že se ti draci dost podobají?

Mne fascinuje ještě třetí problém, který by mohl uznat jako vědecký i přísný Wothan nebo Divous. Jak to, že tato všeobecná představa draka dává jasný biologický smysl? Všechny jiné bestie totiž, počínaje nejméně Physiologem, jsou potvory zjevně smotnované ze dvou či více zvířat (gryfon, bazilišek, mantikora), které zjevně v přírodě žít nemohou. Pokud je drak chápán jako "had s křídly" nebo "krokodýl s křídly", je to také zjevně smontované. Jenomže ta představa je tak vytrvalá, že spíše vyvolává dojem, že jde o nedorozumění- popisy o tvora tak fantastického a neobvyklého, že ho bylo nutno přirovnat k něčemu známému. Přesně stejný problém byl ve středověku například i se žralokem či velrybou (vyobrazení Leviathana také stojí zato, a s velrybou mají málo společného).

Takže já stojím na té verzi, že draci reálně existují (nebo existovali a vyhynuli v době, kdy o nich nejstarší civilizace mohla mít povědomí). Nejde o přeživšího dinosaura, nýbrž ptakoještěra. Zní to nevědecky a fantasticky, ale připadá mi to jako nejjednodušší a paradoxně nejspolehlivější vysvětlení Anonymovy otázky.
Wothan26.2.2003 (9:49)
Mně baví jak se může někdo vážně dohadovat o procentech obsahu "genetického kódu" u fiktivní mýtické bytosti jako je drak :-) Za chvíli budete probírat konkrétní aspekty dračího DNA ne? Pokud vážně potřebujete pitvat draky, asi vám stejně nezbyde než se pustit do ještěrů a ještěrek :-)
Argonantus26.2.2003 (10:01)
Ta procenta přinesl na scénu Darkelf - a pokud vím, nikdo s ním nepolemizoval. Pokud jsem dával ve škole pozor, 97% genetického kódu VŠECH pozemskýh tvorů (včetně Wothanových bakterií se špičatou čepicí a Wothana samotného) se shoduje - rozdíly jsou jen v tom malém zbytku.
Nesměj se, a řekni jasně, vědče - proč jsou draci všude po světě? A proč je tato představa konsistentní?
Wothan26.2.2003 (11:37)
No tak docela zace konzistentní není - přece jen v pojetí draků najdeš rozdíly i v rámci Evropy, natož světa. Je podobná i když se pohybuje vesměs od hada (případně okřídleného hada) na jedné k plazu (i více nohému) na druhé straně. Konzistentní není ani v tom co draci chrlí i když se často shudují. Drak jako mýtická postava je velmi stará bytost, takže bude mnohým národům společná tak jako mají společné kořeny. Něco by se dalo vysvětlit také kulturními styky. Pokud vychází představa ze zvířat - plazi žijí na většině světadílů a nepodceňoval bych lidskou fantasii - pokud ano, asi bychom se tu teď a tady nebavili že? Stejně tak mohlo jít o chybné interpretace nálezů - viz. třeba dynosauří "dračí kosti" v Číně (nebo Barberiniho zaručeně pravé artefakty...). Když budeš skeptik, sneseš na misky vah přinejmenším stejnou hromádku argumentů jako člověk který se "existenci" draků pokusí dokázat, ne-li víc. Jen to podle mne postrádá smysl - dokazovat existenci mýtických postav...Álfů, draků, bohů, příšer...
Argonantus26.2.2003 (11:55)
Wothan: Protože mne ta představa možné reálnosti draků čímsi vzrušuje a naplňuje úžasem - stejně jako draci vůbec a všeobecně. To je jeden z důvodů, proč jsem založil tohle fórum.
Mám pocit, že to tak funguje i na další víceméně vědecké typy - tu tvoji kamarádku restaurátorku, která jaksi nad plán vychrlila zajímavý článek; tebe samotného, že jsi na té rekonstrukci mandlového šítu použil zrovna a právě draka; Divouse, že napsal heraldický článek o dracích, a zcela nad plán řeší jejich vzhled - a tak dál. Je nás docela hodně, a je to společnost úctyhodná - od Tolkiena přes Louise Borgese někam do starověku. Šach!

Ale k věci - tvoje námitka proti mé údajné kozistentnosti draků je docela dobrá; skutečně se od sebe liší, takže to vypadá, jako když se mluví o více zvířatech (had, plaz, krokodýl atd.) Můj problém je, že jsem věc vnímal pouze jako jádro myšlenky - LÉTAJÍCÍ DRAVÝ PLAZ, což konsistentní je.

Nemohu nijak dokázat, že se v pozadí všech těch zmatených zpráv a popisů, vesměs z ixté ruky, mezi jasnými zmatky a omyly (brněnský drak) skrývá skutečně reálné vědecky neprokázané zvíře. Nicméně vzhledem k úžasnému počtu a vytrvalosti těchto zpráv (od keltských mincí přes středověk až k tomu kongamatu) to určitá možnost je.

A pro upřesnění - tento základní problém (reálnost draků, made by Fanda, Anonym a já) nemá žádný vztah k debatě s Darkelfem o původu dračí magie (která je méně vědecká, nicméně ne nezajímavá).
Wothan26.2.2003 (13:29)
Argonautus: mám rád draky jako mýtické figury, toť vše. Když chci na štít vměstnat symbolickou patronaci sv. Jiří v nějaké předheraldické podobě a nechci tam malovat pravoslavné ikony (jednu máme na praporu, ale pro románský štít je to naprosto nevhodné) zbude nakonec zase jenom ten drak.

U té podobnosti - někdy je obávám se přání otcem myšlenky. Mimochodem okřídlení plazi samozřejmě také existují dodnes žijí. Svět je už poměrně malé místo aby se tu skrylo tak valké létající zvíře, pokud někdy něco podobného žilo stejně nezbude než hledat fosílie - a ty jsme našli i když poněkud staršího data.
darkelf26.2.2003 (13:45)
Fanda: Rozdíl mezi draky bych přissuzoval kosstrám různých druhů plazů, které byli v té či oné inkriminované oblassti nalezeny. Jelikož v Evropě nebyli doloženy nálezy obřích ssauropodů, nemohli naši předci nalézt dlouhé hadovité páteře jako v Sseverní Americe nebo ve východní Assii, kde je předsstava drako sspíše jako velkého hada než ještěrky (i když čínsský drak je mutant mnoha ruhů zvířat).
A jelikož naši přdkové nebyli tak hloupí, ussoudily, ¨že obří protáhlé lebky nemohou patřit nikomu jinému než velké přerosstlé ještěrce.
Argonantus26.2.2003 (13:55)
Máš-li na mysli dráčka létavého (odněkud z Asie), ten existuje bezesporu. Nicméně i to je zřejmě falešná stopa - technicky si neumím představit, jak by tohle zvíře mohlo dosáhnout větších rozměrů, než foxteriér.
O existenci draků samozřejmě nelze kovaného skeptika přesvědčit - důkaz prostě chybí.

Nicméně připomínám ještě - než to s tebou vzdám - skutečnost, že lidé o existenci draků vůbec nepochybovali asi až do francouzské revoluce; a o pár desetiletí později byla věda nucena uznat pravěké ptakoještěry. Takže lidé na draky déle věřili, než nevěřili (dnes věří naprosto všemu).
Ostatně, argument o velikosti planety není moc přesvědčivý- pokud vzpomeneš na historii Latimérie, žraloka Megachasma (zjištěn 1976), okapi či tak banálního zvířete, jako je gorila. Ostatně, netrvám na Marešově kongamatu jako prokázané věci. Spíše mi jde o dobu, kdy se takové zvíře mohlo velmi bezpečně prohánět po světě (u nás ranný středověk, kdy většinu plohy tvořil les; v Africe přinejmenším do předminulého století), aniž by muselo být objeveno. I to se stalo - víš, kdy vyhynuli obří pštrosi rodu Aepyornis nebo Moa? A to rozhodně není malé zvíře...

Také vnitřní, mýtická rovina problému mne zajímá. Jednak je to ta nádherná samozřejmost, s jakou lidé tehdy v draky věřili.
A jednak ti tak úplně nevěřím, že jsou pro tebe draci jenom vhodným materiálem na štít z tvé oblíbené doby (mimochodem, u mně rovněž zcela nejoblíbenější, konkétně doby krále Vladislava). Mohl jsi použít leccos dalšího. Lva, který je neméně univerzální. Orla. Gryfona (s tím si jsem méně jist). Určitě kohouta nebo havrana. Víš přinejmenším stejně dobře, jako já, že s heraldickými draky to u nás tak slavné není (ten Vražda a Dražický z Kunvaldu jsou o dost pozdější doba). A ten svatý Jiří - který v té době nijak zvlášť v módě nebyl - přiznej, že to je jen záminka! Že tys tam prostě chtěl mít draka! Šach!
darkelf26.2.2003 (14:02)
Argonantus: Morfologicky je třeby drak létající tvor, ale jisstě byl sschopný pouze klouzání na menší vzdálenossti (příkladem jssou "Draco volans" dráček létavý). To že jssou vůbec sschopni letu, lze přissuzovat magii.
Tvůj kandidát na draka Dimorphodon jisstě vypadal hrozivě, ale nedával bych jim příliš velkou naději (velký a ještě k tomu létající tvor by assi katasstrofu na konci Druhohor nepřežil). Mimochodem v té době exisstovali větší druhy ptakoještěrů.
Něco málo k beholderům: mně připadají velmi reální. Takoví budoucí předci chobotnic (komorové oči, velká inteligence, chapadla) a když přičtu k tomu jejich velkou adaptabilitu, možná náss podobní tvorové jednou nahradí.
a jejich magie nemussí být sspolečná ss draky, ale určitě jssou sstarší.

Evoluce nemá pravidla, tak proč by nomohl mít šesst končetin! (Drak)...a taky ss nima vypadá líp....jinak já ossobně beru draka ss křídlama míssto horních končetin za wywerna a nelétajícího draka za Ssaň.
Argonantus26.2.2003 (14:06)
Darkelf : tvoje odpověď přišla doprostřed mé reakce na Wothana. Takže sorry za zmatek.
Nicméně tvoje poznámka o kostrách je také na pováženou. Rozhodně nelze vyloučit, že někdo našel ve starověku či středověku páteř a žebra sauropoda, což při dnes uvažovaných délkách přes 30 metrů byl jistě důvod k zamyšlení. Čínské draky by to do jisté míry vysvětlovalo (ale zase - co to létání? Kostra sauropoda může vyvolávat různé úžasné představy, ale létání nejméně ze všeho!)
Horší je to s Americkými. Hlavní oblast dinosaurů je ve Wyomingu, Montaně, Utahu, Novém Mexiku, Dakotě, Albertě a podobně. Opeřený had je specialitou Střední Ameriky. To je dost daleko... a navíc, pokud vím, severoameričtí indiáni opeřeného hada neznají.
A pak by měl být hadovitý drak v Africe, kdebyli sauropodi také...
darkelf26.2.2003 (14:14)
Argonantus: Sspecifikuj předsstavu sseveroamerických draků.
No opeření hadi by sse dali vyssvětlit předpokládaným malým kontaktem vysspělých středoamerických a jihoamerických kultur. Zde předsstava draka assi sspíše tvorili velcí škrtiči (anakkonda, hroznýši). Okřídlený had byl assi jejich jediné vyssvětlení božsství. všichni lidé, když myssleli na ssvé bohy, kouali na oblohu. Quetssalcoatl, okřídlený had, sse prosstě nějak mussel pohybovat po nebessích (a všude lítalo tolik ptáků).

Tu Afriku bych vyssvětli assi tak, že v Africe sse za tu dobu událo příliš mnoho změn a kossti dinossaurů sse jen ak nepovalují na vyprahlém píssku, jako je to třeba na poušto Gobi.
darkelf26.2.2003 (14:17)
Ssspeciálně pro Wothana: dračí gen pro chrlení ohně TTACCAAGGTGAGAATCGTAAAACTGCATGCAATTGGCAGGCTTAGCAATGCCATTGCATGCAAAAACGATACGATCAGTACGATACGATACGACGACATACGCATGGCGGACT
Argonantus26.2.2003 (14:20)
Darkelf ještě jednou:
K létání Dimorphodona - tohle je dost složitá věc, protože je hrozně málo nálezů. Klasický pozitivní vědec by řekl, že Dimorphodon sice má křídla, ale protože ho nikdo létat neviděl, tak nelétal vůbec. na létání jsou různé teorie, které souvisí s módními otázkami teplokrevnosti. Starší škola učila pouze o klouzavém letu na způsob Draco volans (i když křídla jsou úplně jiná). Dnes se vyskytují i zastánci aktivního letu a způsobu života (tohle přetiskuje a shrnuje Mareš docela dobře v citované knize).

K-T katastrofa, čili Alvarezův meteorit, čili vyhynutí dinosaurů na konci křídy, čili to, čemu říkám prostě Pád: další módní záhada; zda něco přežilo a kolik toho bylo, to lze říci opravdu těžko. Dimorphodon zas není až tak velký - je otázka, jak ho měříš; má dost velké rozpětí, ale ne zas až tak velkou váhu, neb létá (nejvýše desítky kil; v maximální verzi metrák).
Proč zrovna dimorphodon, a ne něco většího - protože to "něco většího" paradoxně není tak dravé a agresivní, aby se toho někdo bál, snad s výjimkou pteranodonů. A protože - viz Mareš.

Beholdery vzdávám. Mýtická povaha chobotnic je zajisté hluboká a zásadní také; i zde se skrývají zřejmě různá překvapení; také by šlo vzpomenout na Cthulhu; ale to je spíš na jiné fórum. Pro nás, pozemní středoevropany, je to exotika.

Proč by evoluce neměla mít pravidla? Věda má pravidla; heraldika má pravidla; magie má pravidla. Přesto jsou na světě úžasné věci.
darkelf26.2.2003 (14:29)
Argonantus: Tady je otázka jesstli ta tvoje lítající ještěrka je předek draka! Ssice do určité míry sse jednalo o teplokrevného živočicha, protože byl sschopen většího pohybu, ale proč ho sspojuješ ss drakem? (Já jssem tím sspíše chtěl naznačit, čím byli draci dříve, než sse sstali draky!) Pro takové tvory jako je drak je aktivní způssob letu, jak jssi poznamenal, docela nemožný. Tolik energie, co musí vynaložit, aby sse odpoutal od země....fíha...a kolik jí potom té zemi předá....mno, docela by tím ničil okolní krajinu.

Pokud by tuhle katasstrofu přežil, mussel by sse během několik "dessítek" let přizpůssobit. Ale není to moc rychle.......to zavání něčí jiným než lidsským ssmysslem pro realitu. (ale my, elfové!)

Věda nemá pravidla, věda má pouze posstuláta a to jenom proto, aby sse něčho mohla chytnout. Magie by mohla mít nějaký pravidla!
Wothan26.2.2003 (14:47)
Darkelf: děkuji, to by pro klonování mělo stačit - zkusím to naroubovat na mloka :-)

Argonautus: je mi líto, ale tahle planeta je skutečně příliš malá na velké objevy. S výjimkou asi rostlin, drobných organismů, hymzu nebo mořských hlubin kde nás ještě hezká řádka zajímavostí čeká, včetně těch rozměrných (z nejznámějších třeba olihně-krakatice) bych na souš moc nesázel. Pralesy se zmenšují a neprostupná místa jsou stále lépe zmapovaná. Drak, ať už vezmeme kteréhokoli, by bylo poměrně velké zvíře - navíc létající, něco takového by se jen velmi obtížně skrývalo kdekoli.
argonantus26.2.2003 (17:18)
Wothan: nemohu než odkázat na moji repliku z 26.2. z 13.55, je celá určena tobě, jen tam chybí Wothan v čele. A na této pravdě vesele chci zemřít. :-)

Darkelf: S tebou je to složitější. Zkusím rozmotat, co jsem dosud nezodpověděl.
Létání - viz 14.20 na počátku. Doplňuji jen, že Draco volans létá principiálně jinak, než Dimorphodon. Draco volans má křídla z prodloužených žeber, a to jednak neunese moc velké zvíře (odtud má teorie foxteriéra), jednak to skutečně nelze užít jinak, než jako rogalo. Dimorphodonova křídla - připomínající netopýří - umožňují let aktivní; vše ostatní je výdej energie; a to, že by tím ničil krajinu, je tvůj ekologický elfocentrismus.

Zda je dimorphodon skutečně předek draka - co já vím? Jsem jen Argonantus, a tenkrát jsem chyběl. Ale je to pro mne vítězný typ - nic jiného tak pěkně nevyhovuje (dokonce, a to jen jako jemný špílec pro Wothana - dimorphodon vyhovuje i jako zajímavý předchůdce inteligentní bytosti. Je velmi málo specializovaný, kolektivní, všežravý, má obratné drápky. Dále viz Carl Sagan.)

A ještě ti severoameričané: Právě že tam draci chybí (a jak by řekl správně Anonym, taky tam dlouho chyběla civilizace). Promítnutí obávané anakondy na oblohu je právě ten psychologický trik, kterému jsem se chtěl vyhnout (to by provedl Jung a zřejmě Wothan - ale ať nám důvod existence draků řekne sám).

Připomínám znovu, že had i ještěr, a vůbec jakýkoli plaz známý v té době je obzvlášť pitomý kandidát na létání. Proč necpali naši předci na nebesa lva, hrocha, slona, medvěda...? Proč to u všech všudy musel být vždycky plaz, znova a znova? Tak se ptal Anonym, a tak se ptám i já.
Wothan26.2.2003 (18:22)
Argonaut: porovnej aktivní let netopýra s aktivním letem kondora...vím je to pták, ale principielně jeho křídla umožňují let aktivní, přesto je praxe poněkud jiná.
Fanda26.2.2003 (18:49)
Uff, to je příspěvků, takže jenv krátkosti:

1) Nikde jsem nenapsal, že obhajuji reálnost drkaů

2) Evoluce rozhodně nespočívá ve zvětšování

3) Evoluce je sice slepá, ale má své zákonitosti - 6 nohou by např. chtělo dost složitou mutaci v oblasti Hox-genů, vlastně jedněch z nejzákladnějších stavebních kamenů organismu a udělalo by to dost velkou paseku

4) Pokud nebude nový druh přesvědčivě doložen, je lépe býti skeptický.

5) Draco volans je agama z JV Asie a létá klouzavým letem - tuším, že plachtích po svých žebrech

6) Křídla kondora umožňují aktivní let jen na velmi malou vzdálenost - létá pasivně - plachtí.

7) Případ lebky medvěda vydávané za draka je dost vykřičený případ. Ostatně první kost dinosaura (byl to Iquanodon) byla popsána jako Scorum Humanum - ti kteří znají medicínskou latinu, nechť přeloží těm neznalým.

8) V případě draků by to asi opravdu chtělo vysledovat původ těchto slov v jazyce - z čeho vznikly, co znamenaly. Jinak to opravdu sklouzává k tomu, že se tu hádáme o shodě pojmové - létající ještěra je zkrátka drak a naopak.

9) Dle současných teorií se teplokrevnost předpokládá k nutnosti aktivního letu.

10) Jaký je rozdíl mezi lvem s orlí hlavou a orlými křídli a hadem s netopýřími křídly? Jinými slovy i drak může být jedna z těch skloubenin.

Tak je asi zatím vše.
Frelin26.2.2003 (21:00)
Hmmmmmmm... No chvíli mě to dalo než sem se vůbec dostal až na konec týhle diskuze... ALe i já něco přidám... Draci, jelikož sou dost chytří, tak se můžou ukrývat i v dnešní době... I když pralesy mizej, podle mě jich je ještě dost. A pak lítaní a hadi. CO když nějakýho hada chytil pták, had mu za letu spadnul a lidi si řekli: Had a lítá!!! A z toho vzniknul drak...
darkelf27.2.2003 (8:12)
argonantus: Dimorphodon měl mysslím docela malej poměr hmotnossti těla ku křídlům i tak pochybuji, že by sse jen tak vznessl máváním křídel ze země. Většinou využívali nějakých útessů (aliass Wothanův Kondor, tam sse opravdu o aktivním letu mluvit nedá). Jinak jak jssem naznačil, i kdyby aktivně lítal drak, jenom při vzletu by vznikla taková nártazová vlna, že by v okruhu několia mertů lítali sstromečky.
Všichni ptáci jssou kolektivní a kam to vedlo?! Radši bych fandil chobotnicím!
Sseveroameričani jssou vyřešeni a létající hadi taky!
Proč nenacpali předci na nebessa lva, medvěda a sslona? Koukni sse na hvězdy a poznáš pravdu! I Ganéša umí létat! Proč zrovna plaz? Protože!
darkelf27.2.2003 (8:22)
Frelin: A podzemí je taky velký
darkelf27.2.2003 (8:22)
Fanda:

1) toss nenapssal
2) to teda nesspočívá
3) sslepá není, jde ss určitým cílem...ale někdy sse prosstě mine účinkem. Extrémní změny chce extrémní podmínky - 6 nohou, proč ne?!
4) optimissti sse dožívají vyššího věka, takže draci jssou.
5) To všichni víme!
6) To ale drakum nesstačí (krátká vzdálenosst)
7) no jo, ale nebyli první, kdo je našli. A dobrý hisstorky vydrží dlouho.
8) to jo.
9) na zemi možná, ale není nutnosstí
10) ...?...?
Wothan27.2.2003 (8:28)
Fanda: uváděl jsem toho kondora schválně - je to hezký příklad rozporu k jakému by mohlo dojít pokud by se porovnávaly pouze kostry - kostra kondora a kostry jiných ptáků. Principielně by tu neměl být žádný zásadní rozdíl a přesto v praxi je. Jenže kondora naštěstí můžeme vidět v letu, dynosaury už bohužel ne takže nad jejich fosíliemi spekulujeme...
Argonantus27.2.2003 (9:51)
Fandovo desatero:
1) Reálnost draků obhajuji já. Netrvám na ní - neb kajícně doznávám, že důkazy nemám. Jenom upozorňuji, že tu taková možnost je. Když se poprvé mluvilo na počátku 19. století o ptakoještěrech v pravěku, také se všichni smáli.
O existenci draků v současnosti nejsem úplně přesvědčen; ale pro zajímavost jsem řekl, že i to tvrdí partička zoologů (Mareš, Mackall a další - zjevně jsi to četl taky, Fando).
Daleko slibnější je možnost existence draků v ne až tak dávné minulosti.

2) Zvětšování samozřejmě není podstatou evoluce, ale v evoluci jednoho druhu bývá typickým jevem (viz kůň, snad nejlépe doložená a prozkoumaná řada). Konkrétně - pokud měl dimorphodon kolem dvou metrů rozpětí, za sto milionů let mohl mít několik metrů (ale asi ne třicet, jak chce tradice).

3) Šest nohou je kravina. Na tom trvám. A dokonce mohu šestinohou potvoru vysvětlit jinak - když zkoušeli nakreslit létajícího plaza se dvěma nohama (keltská, správná verze), zdálo se výtvarníkovi, že to vypadá úplně divně (a v hadovité verzi fakt vypadá). Tak dvě nohy přidali.

4) Určitě. Taky nepíšeme disertační práci, nýbrž jen plodně tlacháme. A mimochodem, stou skepsí se to zas nesmí přehnat. Ještě okolo roku 1920 se vážně tvrdilo, že svatý Václav je vybájená postava. Osobně jsem zažil řadu velkých překvapení... ale to je spíš na órum hermetismus.

5) Jo. A s draky to nemůže souviset.

6) Jo. Ale k létání draka a jeho předka nám to nevypovídá vůbec nic.

7) O těch kostech jsem už slyšel dříve, ale dostalo mne, jak trefně to předvedl Darkelf. Mongolský - nebo čínský, chcete-li - válečník stojí v poušti nad kostrou velkého sauropoda... měl rozumný důvod o dracích pochybovat?
Tenhle obraz nám ale nevysvětluje všechno - jednak to létání, jednak ty Kelty a Řeky.

8) To je pravda. S tímhle jsem začal já. Považuji ideu létajícího dravého ještěra za neobyčejně mocnou a vytrvalou, a vlastně dost záhadnou. To byl jeden z mých hlavních argumentů. Jak s tím souvisí poměrná jazyková vytrvalost poměrně panevropského slova "drak", to nevím, nejsem odborník.
A takové případy, jako Draco volans z toho vylučuji jen pro důvody evoluční a biologické (je to evoluční paralela podobná, jako jsou delíni, žraloci a ichtyosauři - případně ptakoještěři a netopýři.)

9) Jo, to jsem právě tvrdil. Nicméně tady má pravdu Wothan - létání ptakoještěrů je dost moderní a složitá věda, když máme jen kostry - a u draka nemáme ani tu kostru. Takže u létání se těžko dobereme konečné verze.

10) Zřejmě právě ne, a to je to zajímavé. Kdyby byl drak opravdu pravidelně a spolehlivě kreslen jako had s křídly, pak máš pravdu. Jenomže zde je třeba obrátit Wothanovu námitku proti němu - právě proto, že drak je kreslen pokaždé jinak (článek té restaurátorky na wothansburgu, článek Divouse a spousta jiných), vypadá to, že jde o pokus o několikerou rekonstrukci podle různých, nedokonalých zpráv. Představ si duševní cvik - jsi středověký mnich, a právě ses setkal s cizím kupcem, který ti popisuje DRAVÉHO LÉTAVÉHO JEŠTĚRA. Použije při tom - jak jinak - plazy, které znáš. Výsledkem tvého obrázku bude zbastlenina. A u různých autorů různá (viz moje úvaha o přidání nohou pod 3). Jak jsem řekl nahoře - přesně to samé proběhlo ve středověku s velrybami; podle většiny kreseb bys velrybu nepoznal. A divíš se, když byl autor suchozemský mnich?

Frelin: jen glosa k tvému nápadu - v jednom zápise kanovníka Vyšehradského, někdy ze čtyřicátých let 12. století, nemýlím-li se, je lakonická věta "bylo viděti létati hada."
Netuším, jak a proč k tomu došlo - ale mimochodem, hada a draka dovedli rozeznat.
Argonantus27.2.2003 (10:04)
Wothan: Jo, a Wothane, ty jsi mi utekl s mým nevhodně osobním útokem. Za masku chladného vědce se přede mnou neschováš. Ty máš ty draky rád, přiznej se - jinak bys s námi tady neblbnul a nemaloval je na mandlové štíty.

Inzeruji znovu - tahle psychická rovina draků mne také zajímá. Draci mají své uhrančivé kouzlo; kdo je na to náchylný, tak na ně myslí a občas se k nim vrací. To je prostě fakt; kdybych tu založil fórum "mantikory" nebo"létající hroši", tak daleko bychom se nedostali.
Wothan27.2.2003 (10:37)
Argonaut: já jsem na to odpověděl. Mám je rád jako mýtické figury (podobně jako spoustu jiných bájeslovných postav), mám je rád ve výtvarném umění a konečně mám rád plazy...přesněji především ještěry.
Argonantus27.2.2003 (12:55)
Wothan: Jsi zatvrzelý, mistře. Nemohu ti dokázat, že "spousta jiných mýtických figur" není pro mne, ani pro tebe úplně totéž, co drak. Mohu tě z toho jen podezírat.
Taková amfisbéna je sice zajímavá, ale "jen" zajímavá. Drak je proti tomu magie. Drak je vášeň. Drak je fantasie. Drak je provokace.
Věděli to už tenkrát; oficiální vysvětlení svatého Jiří (a jemu podobných obrazů) je různé - náboženský, hermetický a kdovíjaký symbol. Mám podezření, že to malovali taky proto, že tam chtěli mít draka.

Obdivuji realisty; ještě více si vážím těch, co jsou vším, čím já nejsem (co jsi zač, je jasno z fóra "šerm"). Nemohu ovšem nepoznamenat, že my druzí, nepořání mágové, kteří nevíme, kterým koncem se meč vlastně drží, jsme magií méně zranitelní - protože o ní víme. Ale to patří do jiného fóra (hermetismus).
Buď zdráv a vytrvej. Wothanburg je geniální. Konec odbočky.
Fanda27.2.2003 (16:09)
Mé desatero 2 Turbo:

1) Já jen že jsem byl uváděn mezi zastánci. A Mareš je kryptozoolog, což je banda divných lidí, asi tak jako ufologové, a k těm se slušný zoolog nehlásí a věřit se jim dá asi tak jako domorodcům, tedy vůbec
(teda ne že by zoologové nebyli divní, pár jich znám) ^_^

2) Jo, koně se zvětšovaly. Nejdná se ale o nějaký obecně evoluční trend - u koní došlo ke změně potravní niky z pralesů na otevřené pláně, což si vyžádalo přestavbu končetiny a také způsobu zpracování potravy. A abych ti vyvrátil tvé tvrzení o obecnosti zvětšujícího trendu v evoluci, jmenujme třebas obojživelníky - porovnáš-li ty prvohorní s dnešními, vyjdou ti ti dnešní menší a to podstatně.

3) Hodinář je slepý, běžíme, abychom zůstali na místě - toť mota evoluční teorie současntosti - pokud chcete diskutovat o evoluci, přečtěte si pro začátek Červenou královnu (a že to není suchá četba). Evoluce nemá smysl - jediným smyslem je snaha splodit více potomků / předat více svých genů dál, než ten druhý.

4) Na druhou ani s tím optimismem - pak se může stát, že člověk najde to co hledá jen proto, že si to najít přeje.

....

9) 2 Darkelf: Star Trek sem netahej - ty znáš nějaký jiný život, než je ten pozemský?

10) 2 Argonautus: A taky to může znamenat to, že vzniklo několik nezávislých představ, které jen na základě vnější a nedokonalé podobnosti byli někým, kdo o tom neměl ani páru, pojmenovány stejně.

Jo a pokud jde o ty létající potvory - co takhle hominoidní tvor připomínající ženu s opeřenými křídly na zádech - to je alespoň v Evropě také dost vykřičený létavec.

A vůbec, proč chcete, aby draci existovali? O čem bychom potom snili?
argonantus27.2.2003 (20:06)
Fanda:
Už ne desatero, jen poslední bod, který je ještě zajímavý:
Proč chci, aby draci existovali? O čem bychom snili?

Protože snít o něčem, co by být mohlo, případně, co dokonce bylo, je daleko více vzrušující. Podívej se na rubriku o šermu, a uvidíš, jak lidi jako Wothan zajímá výhradně to, co bylo - ne zbastlené šílenosti, které být nemohly. To je, oč běží zřejmě v celé Pevnosti. To je, co se pokouším vysvětlit na rozdílu mezi drakem a amfisbénou.

Ta vykřičená létající dáma - to je právě to, co zcela určitě být nemohlo (a nejen proto, že má šest končetin). Už Tolkiena značně dopalovala, a já chápu, proč. Je to horší, než amfisbéna a mnohem horší, než Darkelfův Beholder (který je přece jen konsistentní a nějaký mýtický podkres má.)

Bytí a nebytí není tak prostá kategorie; jsou věci, co jsou o dost více, než jiné věci; jsou věci, co nejsou, ale byly; jiné věci nejsou a nebyly, ale být mohly; pak jsou věci, které být nemohly, ale lze si je pouze představit; a pak jsou věci nepředstavitelné, které nejsou, nebyly a být nemohly a nelze ani chtít, aby byly. Šach!
h představ, které jen na základě vnější a nedokonalé podobnosti byli někým, kdo o tom neměl ani páru, pojmenovány stejně.

Jo a pokud jde o ty létající potvory - co takhle hominoidní tvor připomínající ženu s opeřenými křídly na zádech - to je alespoň v Evropě také dost vykřičený létavec.

A vůbec, proč chcete, aby draci existovali? O čem bychom potom snili?
Fanda27.2.2003 (21:40)
2 Argonantus:
Je záhodno, že si to opět stočil zpět k drakům.
Jak je tedy vidět, i okřídlených humanoidů je kopa a já tím svým myslel křesťanského anděla.
Ale zpět k tvé reakci - nějak ses v té rozsáhlé filozofii sám zamotal a otázkou je, kam dát draka - pro mě kategorie předposlední (nebyl, ale dovedu si ho představit). Pravdou také je, že to co si dokážeme, nebo nedokážeme představit také záleží na tom, co o dané věci (nebo jí podobné) víme nebo nevíme - a to platí také o tom, co považujeme za možné, nebo nemožné. Ale nevím, jestli je snění závislé na tom, jestli předmět být mohl nebo nemohl (popř. byl, nebo nebyl) - tvůj příklad s šermem se mi zdá poněkud zcestný, protože o šermu máme tak nějak víc důkazů jeho existence a ty nám u draků chybí - kromě zkazek, ale lidi toho namluví. Je také dobré pamatovat na to, že drak, jak ho známe my, je zkrátka symbol, ztělesnění majestátné hrůzy (alespoň tedy v Evropsko-křesťanské tradici) - ostatně netopýří křídla se tak nějak přifařovala všemu pekelnému, a čert ví, jak to s ním doopravdy bylo (a budu se držet raději v Evropě, protože přes povrchní podobnosti nejsem sto říct, jestli "draci" jiných kultůr s tím naším mají něco společného).
A nějaké nové moto závěrem (^_^): Kdyby draci nebyli, lidé by si je asi stejně vymysleli.
Wothan28.2.2003 (9:07)
Kdo to promazal?!
Argonantus28.2.2003 (9:50)
Fanda:
1) Jo andělé? To jsem nepochopil, myslel jsem na předtolkienovské elfy a víly. Proč by, u všech mantikor, měli být andělé ženské??

2) Ta filosofická rovina problému je kardinální, a proto se k ní vracím. S tím šermem - není pochyb, že existoval. Nicméně je šerm historicky věrný a fascinující, je šerm, který být mohl, ale nejspíš nebyl, a je šerm úplně nemožný, který některé lidi dopaluje. Nešermuji, ale úplně chápu, proč. Viz to fórum (fakt tam zajdi). Věci, které jsou in potentia možné (jak by řekl kolega Akvinský) jsou prostě mnohem zajímavější, než ty nemožné- a ty, co jsou skutečné (in acto), ale my jsme to netušili, jsou přímo ohromující. Tvoje golsao potřebě draka míří právě sem. Kdyby si nikdo nevymyslel amfisbénu, svět by byl sice chudší, ale nic tak zásadního by se nestalo.

Wothane, pomoz - biju se i za tebe!!

3) Odmítám, že draci nejsou a nebyli. To mi připomíná onoho nešťastného papeže ("kameny nepadají z nebe, protože si to nepřeji.") Navrhuji kompromisní, policejní závěr : PŘÍTOMNOST DRAKA V DOBĚ HISTORICKÉ NENÍ MOŽNO POTVRDIT, ANI VYVRÁTIT.

4) Nedávno zesnulý Carl Sagan říkal o mýtické povaze draka zajímavé věci. Lidé - a potažmo všichni primáti - mají podvědomou hrůzu ze všech plazů; v jejich snech figurují plazi a hadi výrazně nejčastěji, hned po lidech (osobně poznamenávám - v mých jo.) Nejde náhodou o to, že plazi byli pro primáty vždy tím nejhorším nočním nebezpečím; není to přetrvávání dávné války s dinosaury v podvědomí?

Wothan: Kdo co promazal, proboha?
Argonantus28.2.2003 (9:50)
Fanda:
1) Jo andělé? To jsem nepochopil, myslel jsem na předtolkienovské elfy a víly. Proč by, u všech mantikor, měli být andělé ženské??

2) Ta filosofická rovina problému je kardinální, a proto se k ní vracím. S tím šermem - není pochyb, že existoval. Nicméně je šerm historicky věrný a fascinující, je šerm, který být mohl, ale nejspíš nebyl, a je šerm úplně nemožný, který některé lidi dopaluje. Nešermuji, ale úplně chápu, proč. Viz to fórum (fakt tam zajdi). Věci, které jsou in potentia možné (jak by řekl kolega Akvinský) jsou prostě mnohem zajímavější, než ty nemožné- a ty, co jsou skutečné (in acto), ale my jsme to netušili, jsou přímo ohromující. Tvoje golsao potřebě draka míří právě sem. Kdyby si nikdo nevymyslel amfisbénu, svět by byl sice chudší, ale nic tak zásadního by se nestalo.

Wothane, pomoz - biju se i za tebe!!

3) Odmítám, že draci nejsou a nebyli. To mi připomíná onoho nešťastného papeže ("kameny nepadají z nebe, protože si to nepřeji.") Navrhuji kompromisní, policejní závěr : PŘÍTOMNOST DRAKA V DOBĚ HISTORICKÉ NENÍ MOŽNO POTVRDIT, ANI VYVRÁTIT.

4) Nedávno zesnulý Carl Sagan říkal o mýtické povaze draka zajímavé věci. Lidé - a potažmo všichni primáti - mají podvědomou hrůzu ze všech plazů; v jejich snech figurují plazi a hadi výrazně nejčastěji, hned po lidech (osobně poznamenávám - v mých jo.) Nejde náhodou o to, že plazi byli pro primáty vždy tím nejhorším nočním nebezpečím; není to přetrvávání dávné války s dinosaury v podvědomí?

Wothan: Kdo co promazal, proboha?
Argonantus28.2.2003 (9:57)
Ksakru... další kiks, tentokrát můj. To už jsem magor??
darkelf28.2.2003 (9:57)
Wothan: Teď jssou nejnovější přísspěvky nahoře, taky mě to dosstalo!
darkelf28.2.2003 (9:58)
Assi ssi udem pssát mezi prssty, tak .......
darkelf28.2.2003 (10:11)
Fanda: (k poznámce ze SStar Treku)... velká nevýhoda lidí je ta, že dokáží přemýšlet pouze ve dvou rovinách (ssem tady a co sse kolem mě děje, sse prosstě děje všude, nic sse nemění, příroda sse nemění!). Všechno má ssvoji logiku, vše má ssvoji rovnici života.....všechno běží podle nějaké závisslossti. Odchylky nejssou přípusstné! I had může létat, ale proč by to dělal, když sse má na zemi tak dobře, proč by měli ryby aktivně létat, když sse mají ve vodě táák dobře, to že žádný sstudenokrevný nelétá, je pouze tím, že už našli to nejlepší, co mohli (a nevzdali sse toho několik miliónů let)!
Argonantus28.2.2003 (10:12)
Darkelf: nebo chapadly.

Hele, jsou draci, nebo nejsou? A co tvé elfí podvědomí o dracích? A co říkáš článku, který se tu zjevil?
darkelf28.2.2003 (10:29)
argonantus:
Draci určitě jssou, jako jssou elfové a TrPašíci. Mussíš věřit! Ssice to není realita, ale kdo z náss ví, co to realita je?
Elfové a draci? Záleží kteří draci a kteří elfové. Budu mluvit za Temný elfy. Drak je sstarší rassa moudrých, magii ovládajících okřídlených "Šesstinových" (posslední pár jako křídla) plazů ss velkým teritoriálními ssklony. Draci jssou nadmíru neutrální a nelze ss nimi počítat v nějakých Ssuperválkách mezi dobrem a zlem. Další rovinou našeho pohledu je jejich využití v menších podzemních konfliktech jako žoldnéřů. Posslední asspekt je to, že z draka sse nají větší vessnice z průběhu jednoho měssíce a šupiny sse dobře ssměňují.

Jaký článek?
Argonantus28.2.2003 (10:34)
Darkelf: Zajdi na hlavní stránku, a uvidíš.

Jak se dá drak najmout jako žoldnéř? To je možná ještě úchylnější, než se měnit v člověka!
Argonantus28.2.2003 (10:37)
Darkelf:
Jo, a abych to nezakecal - já bych taky neviděl realitu jako něco tak úplně jednoznačného (viz mojich posledních replik Fandovi).
V jiné realitě své existence se docela slušně živím něčím, co podle lidí, jako je Fanda, vůbec neexistuje.
darkelf28.2.2003 (10:50)
argonantus : Jo, přečteno. Dobrý článek, ale nic nového pro mě!
Draci nenávidí lidsskou rassu (pssal jssem už o tom - požírání pan atd.), takže není problém ho přemluvit k malé válečné výpravě. Temní ssi vezmou to co púotřebují a drak ssi zabije pár lidí, ssem tam dosstane na podnosse hlavu paladina a jiných vyvrhelů, kteří mu neusstále ussilují o život pro česst a sslávu!
Taky sse v jiné realitě živím docela (ssice né moc odlišným, ale jiným) nsež v druhé! A když dokážeš žít jak v jedné, tak v druhé realitě, proč ne!



Darkelf:
Jo, a abych to nezakecal - já bych taky neviděl realitu jako něco tak úplně jednoznačného (viz mojich posledních replik Fandovi).
V jiné realitě své existence se docela slušně živím něčím, co podle lidí, jako je Fanda, vůbec neexistuje.
Wothan28.2.2003 (11:04)
Buď je něco se systémem, nebo tu někdo zase systematicky maže příspěvky...mně vážně nebaví psát příspěvky které za pár minut zmizí.
Wothan28.2.2003 (11:05)
Bóže já jsem dement - oni otočili pořadí příspěvků a já se stále dívám dolů...no nic, nic nezmizelo jak koukám. Takhle se to skutečně bude číst lépe.
Fanda28.2.2003 (12:12)
Darkelfe, zdáš se býti dobrý magor. Začínáš se mi líbit ^_^
Prokoukli jste mě, už nemá cenu to skrývat - jsem Technokrat ^___^
Jen si nemohu neodpustit upozornit na rize evropský pohled na draky, kterého jste se dopustili ve svých reakcích a zaslepeně opouštíte to, jak své draky viděli např. Číňané.
Jo a pokud jde o ryby - slyšeli jste už o sekrnatkách? Ty mršky dokáží chvilku opravdu aktivně létat!
Ten strach primátů z plazů jsem už zmiňoval - nicméně na Flinstouny raději zapomeňme, neb tady jde spíše o hady (od kterých je jen krůček k obrovským hadům a od nich k obrovským hadům s křídli chrlích oheň namísto jedu).
Já netvrdím, že vysvětlit přítomnost draků v legendách jejich existencí není možné, já jen upozorňuji na to, že jsou i jiná vysvětlení, která exitenci draků nepotřebují a jelikož tito krom ústního podání nijak doloženi nejsou, jsou tato vysvětlení jednodušší. Jinak řečeno - neexistence draků je hipotéza, která může být vyvrácena, předpokládání jejich existence je víra a s tou nic nehne.

Realita? Pro mě to, co jsem schopen rozpoznat svými smysly a pochopit rozumem.

Jo, mít tak čas, procházet všechny diskuse....
Argonantus28.2.2003 (12:14)
Wothane, aby ses v tom bordelu vyznal - na tebe mířil můj šťouch ve 12.55 včera (nevyžaduje reakci),
a bod 2) dnes v 9.50 v debatě s Fandou (ono to začalo už dřív, ale je to shrnutí). Nechávám na zvážení.

Hele, on nás přec jenom někdo sleduje - ve fóru o zlepšení internetové Pevnosti někdo skuhral, že mu trvá dlouho dojet dolu - a oni ho poslechli!
Argonantus28.2.2003 (12:24)
Fanda: Takže se víceméně připojuješ k mé policejní větě z 9.50. - s důrazem, že ty nmáš tak velkou potřebu, jako já, draky hledat.

Realita - vnímat svými smysly... cha! To máš od Lenina? Nebo od Berkeleye? Tady stojím zcela na straně Darkelfa. S realitou je to trošku složitější; vykazuje celou škálu jemnějších odstínů. Kdybych se držel jen toho, co vnímám smysly:
- zcela bych vyloučil nejen draky, ale i dinosaury a většinu vyhynulých vorů
- nepřipustil bych ani na okamžik existenci některých minulých civilizací
- zcela bych odmítl kvantovou fyziku
- netlachal bych tu s vámi, protože jsem vás v životě neviděl
- nedostal bych plat, a umřel bych hlady
- byl by ode mne konečně pokoj.
Wothan28.2.2003 (12:34)
Hmm, jenže stejně musím dolů když chci reagovat. Ad k Argonautově filosofické rovině, ve Scholastice jsem poněkud plaval...kolega Akvinský pormine, ale kazil mi kdysi dávno známky z filofsofie :-) Jinak souhlasím že věci potenciálně možné jsou zajímavější, protože naše zkušenost při vší vůli stejně vychází především z reality a i sama sebedivočejší představivost reálnou zkušenost nenahradí. Řekl bych že o tom něco vím. Nicméně stran draků musím dát za pravdu Fandovi a jeho logickému vývodu - lze vyvrátit nebo potvrdit hypotézu, těžko se vyvrací víra a při vší vůli stran draků jde skutečně buď o hypotézu nebo o víru.
Argonantus28.2.2003 (13:11)
Všem:
Moje víra v draky... nerad bych, aby to bylo pokládáno za formu svatého vytržení. Pouze v tomto případě už nevystačím s klasickým přístupem Fandovského charakteru - není to prokázáno, ergo
to není. Nevěřím v draky jako se věří v Boha všemohoucícho - spíš hledám draky, protože mne fascinují .
Podle mne tu je příliš mnoho podivností, aby tahle verze stačila; původní

Anonymovu otázku (jaktože jsou draci všude), jsme zkusili zodpovědět:
1) Protože je to náhodná směs různých mýtů, které se jen shodou okolností podobají, a vytvářejí iluzi jediné (Fanda)
2) Protože je to výtvor podvědomí, složený z jakýchsi archetypů (Carl Sagan, částečně Fanda)
3) Protože draci v obě historické prostě existovali a dochovali se z dob starších (já)
4) Protože v jiné rovině reality draci normálně existují (Darkelf)

Nevím - žádná z těch opovědí jaksi nevysvětluje všechno... možná je to kombinace...
Wothan28.2.2003 (13:48)
Víra je od slova věřit a to samo o sobě nutně neevokuje náboženství nebo dokonce fanatismus - představa extatického vytržení z vize draka je skutečně dost legrační :-) Přesto má, podobně jako víra v Boha (bohy, přírodní síly, démony...ad libidum, dle kultury a chuti) principielně stejné základy - její podstata, předmět víry se špatně vyvrací a špatně dokazuje. Co mne fascinuje, tak jako tebe draci je sama potřeba v něco věřit - mám za to že tahle potřeba se kvalitativně mění, jiná byla potřeba pravěkého lovce věřit v přírodní síly, nebo duchy předků, jiná je potřeba lidí znuděných technokratickou společností věřit v mýty...nebo literární postavy (elfy?), ale stále to je nějaká potřeba...kde se bere? Proč? Tohle je elementární filosofická otázka, chceš-li - drak už je jen objekt (jako ostatně třeba elf v jiném fóru).
darkelf28.2.2003 (14:51)
Fanda: No tak dík! Závada není na vašem monitoru........
darkelf28.2.2003 (15:12)
Wothan: Víra je podle mého základ myšlení. Není to nic, co by neměli osstatní tvorové. Je to určitá šance k dossáhnutí určitého cíle. Ale tohle sse už řešilo v elfech, a dosst sse tam všichni motali. Když ukáži psovi koussek massa, neví ss určitosstí, jesstli ho dosstane, ale věří, že to masso dosstane a přiběhne k vám. Jedná sse tedy o nějaký reflex? Výpočetní processor z neuronů?
Víru v Boha nemůžu celkově vzato possoudit, nevím co to je (realita 1). v realitě dvě je to pouze násstroj ke zvýšení šance k ukojení základních činnosstí organissmu (vývoji ...nessmrtelná duše, reinkarnace....,a k rozmnožování).
Lidsský mozek je propojení mnoha vnitřních ssvětů, počítačů a pamětí. Kde sse víra bere, to nikdo neví! Ssnad je předsstava draka dokonce zakódovaná v genetickém kódy, ale nežijeme v době, kdy sse tohle dá zjisstit. a proto lze udělat pouhou jednu věc, posstulát, Draci exisstují a bassta! Kdo nevěří, je kacíř:-)

Argounaute: To co neexisstuje nelze vyvrátit, to co exisstuje zasse nelze potvrdit. žijeme v příliš malém ssvětě, abychom mohly nalézt Draky.
Wothan28.2.2003 (15:44)
Postulát...dogma...axiom...ano to je takové úderné řešení :-))
Fanda28.2.2003 (18:15)
Ha, já si říkal, že jsem tady narazil na filozofy! ^__^
Mohl bych zde pro Agronantovo potěšení vyložit, jak se dají dinosouři pochopit v mé definici ranku reality (známé procesy fosilizace, depositace hornin, morfologická podobnost s jinými formami atd.), ale k tomu ta diskuse neni. Draci u mě, stejně jako elfové, magie apod., náleží do říše Snů - možná je to také nějaká realita, ale ne ta naše a buďme rádi za to, že se tam můžeme vypravit ve svých myšlenkách.
Jak to tak sleduji, možná vysvětlení byla položena a teď už zbývá jen čekat, jak to dopadne. Co tuhle diskusi zabalit a založit novou na téma "Jak mě zmátlo přehození pořadí příspěvků"? ^_^
nojon Džebe28.2.2003 (18:47)
darkelf: Tady bych to viděl právě opačně. Víra je tím, čím disponují pouze lidské bytosti ( bytosti citící se býti efly, trpaslíky nebo dalšími jistě prominou ). Pokud ukážeš psovi kousek masa, instinktivně za ním půjde s automatickým předpokladem, že ho dostane, tudíž jde o vrozené reflexy. Další věcí je jestli zvířata disponují také vírou podobnou té naší v Boha, v to, co následuje po smrti a další. Pokud studie v oblasti psychiky zvířat ukazuje jinak, moje smůla. Jinak definice víra jako "Je to určitá šance k dossáhnutí určitého cíle." nevystihuje víru tak docela přesně. Kupříkladu víra v něčí existenci se tomu poměrně vymyká.
Já osobně chápu víru v Boha dvojím způsobem - věřím pouze v jeho existenci a tím to pro mě končí. Nebo kromě jeho existnce věřím i v jeho spásu, lásku a to, co mi může nabídnout.

Ještě zpětně k tomu co řikal Wothan - Co se týče např. Boha či obdobných věcí. Pro silně věřící se snadno dokazují, ovšem horší to je s ochotou dané důkazy přijmout. Často to bývá také tak, že lidé prostě věřit nechtějí, ať se děje, co se děje.

Pro zajímavost - http://www.volny.cz/anaximandros/tem/tema21.html
argonantus28.2.2003 (20:30)
Wothan i Darkelf:
Jo, tohle se mi dost líbí; kdysi dávno se tvrdilo, že bohové jsou vynalézáni, aby vysvětlili, čemu nerozumíme; Wothan navrhuje pravý opak a já s tím souhlasím. Je potřeba něčemu věřit, aby se člověk je tak neplácal; může to být něco tak subtilního, jako jsou elfové a mýty; nebo tak profláknutého, jako Bůh všemohoucí; nebo i tak prostého, že to a ono má nějakou cenu (což si museli myslet ti maníci, když táhli do Svaté Země - stačilo to, i když byl na ně Bůh moc složitý). Víra je něco složitějšího, než jen "způsob dosažení cíle", daleko víc to souvisí s cílem samotným. V tom má Nojon Džebe recht.

nojon Džebe: Bůh přesahuje téma diskuse, myslím. Strávil jsem nad tím hodiny s mým věřícím bratrem; když tak si otevřeme forum Bůh (a probereme tam i Lilith).

Všem: Nesouhlasím s Fandovým názorem, že draci jsou vysvětlení. Naopak, sotva jsme začali. Zatím jsme vysvětlili jen své vnitřní postoje vzhledem k nim. Ani jsme ještě úplně neprobrali postoj kultur k drakům všeobecně. A co druhy draků; co ten dračí dech; co vnitřní drakův život; co boj s draky (nebo draků s námi...?)
Argonantus3.3.2003 (8:20)
Darkelf: Ještě k chrlení ohně - zkusil jsem ten gen na psovi, a propálil mi klávesnici... asi to funguje...

Wothan a Darkelf: nicméně mám podezření, že chrlení ohně je docela novodobá vymyšlenost... a že starší varianta - středověká - byl jed, který nějak působí na dálku (mluví se o tom v souvislosti s baziliškem - jedna teorie dokone tvrdila, že ho lze zlikvidovat tak, že se mu nastaví zrcadlo, a on otráví sám sebe...)

Ze starších vyobrazení není chrlení ohně obecně patrno (navíc sv. Jiří typicky bodá draka kopím do tlamy, a ohněm by se všechno zkomplikovalo).
darkelf3.3.2003 (12:22)
Fanda: Wothan by mohl povídat!
darkelf3.3.2003 (12:32)
nojon Džebe: Ó ty naivní Humáne. Pouze lidi ssi mysslí, že jejich vlasstnossti patří pouze jim. Tak jak jednoho dne sskončí lásska v popissech enzymatických drav v metabolissmu, tak jednou sskončí i víra! Poté už to nebude to hloupý duchovno a všichni Humáni budou na sstejné urovni jako Žabka Kuňka! Pokud pssovi ukážeš masso, příjde proto, že "věří" (sstejné sslovo je předpokládá, "automatický" ??? jak to jenom můžeš říct. Ale cožpak když věří Humán, nepředpokládá, že toho jednou dossáhne (toho cíle). Nebo ssnad lidé věří v něco jiného. (víra v boha je pouze chuchvalec "prkotin" i životních mouder kolem jedné hlavní myšlenky, na kterou nalákali tolik "věrných", a to nessmrtelnosst....a při ní člověk "automaticky" předpokládá, že nessmtelný bude. Kdyby věděl, že je to blbosst, pochybuji z celé ssvé duše, že by exisstoval Vatikán. Pokud exisstují Humáni, kteří od víry nic nepožadují, pak mě unikla podsstatná čásst lidsského chování!
darkelf3.3.2003 (13:05)
Argonantus: Jak byss chtěl rozdělit cíle člověka. Vždyť je to jenom jedna věc: úspěch a vše ss tím sspojené! Pokud někdo jde za cílem jiným, bývá sspolečnosstí odssouzen (pssychopati a blázni). I ti v podsstatě jdou za ssvým ússpěchem! Kdybys mohl dossáhnout ssvého cíle bez odporu okolí, nepotřeboval byss víru!

Jinak k tvým drakům. Druhů je tolik, kolik na ssvětě běhá barev (alesspoň mě to tak připadá). Ale ve ssvé podsstatě je jeden drak jako druhý! Sspíše sse jedná o sspecializaci na daný biotop!

Ss tím chrlením jedu bych sse chytl Kobry černokrké, která ho chrlit umí. Ss ohněm je to potíž. Ssice jssem sslyšel mnoho teorii (hořlavá kapalina...pluss něco co dává jisskru) a nemysslím ssi, že je to reálný. Předsstava draka který ssebou táhne nějaký kanisstry benzínu mě rozessmívá (obrazně řečeno, kam by tu kapalinu sskládal). Pokud by teda mělo něco hořet, mělo by sse jednat o plyn (navrhoval jssem kysslík, ale ten jssem zavrhl), takže třeba acetylen ss kysslíkem. Proč by nemohl vznikat, díky tajemným kličkám Dračího metabolissmu. Kdyby ho drak vydechoval, odpadlo by problém sse zássobováním! Ledový dech by mohl být zasse tyto plyny, které by díky vyssokým tlakům z prudkých sstahů v dračích plicích by sse mohli zkapalnit a ssnížit tak ssvoji teplotu (??). Blesskový dech (už to zní jak pokémoni) bych přirovnal k třením nějakých desstiček na patře nebo mechanissmuss ala paúhoř. Osstatní výdechy draky bych pouze kombinoval z těchto tří!

Vnitřní dračí život? Wow, i mě by sstrašně zajímalo, jak uvažuje tvor ss větší moudrosstí než Humán!

Jinak kdoví co Ssv. Jiří probodával kopím.
Fanda3.3.2003 (16:48)
nojon Džebe: Když mi maminka připravuje u plotny večeři, tak sedím u stolu s automatickým předpokladem, že ji dostanu... Apropo, velmi pravděpodobně svou víru (víru v Cosi) mají bonobové. A tímto úvahy na téma víra končím.

Všem ostatním drakomilcům bych rád připomenul, aby se při předpokládané rekonstrukci tohoto tvora tak úzce nedrželi toho, jak jej znají z vyprávění, neb lidská tvořivost je velká a třeba z nosorožce dokázala vykouzlit jednorožce.
Hořlavé plyny chytající při výdechu - nevím, ale raději nezapomínat, že dýchací soustava (plíce a ta spousta trubiček, co do nich vedou) jsou v podstatě vnějším prostředím, jenom obráceným dovnitř nás, takže by nám chudák shořel. Ostatně asi jako kdokoli z nás, kdo by se nadýchnul čistého kyslíku...
Wothan3.3.2003 (17:06)
Mno, stran oheň chrlícího draka...tak si taky zaspekuliji. Hořící vzduch (nebo plyn) ne, pokud bych chtěl takového tvora zkonstruovat, nebyl by to plamenomet nebo autogen - měl bych totiž problém se zpětným ventilem. Taky křesat jiskru zubem asi nebude to pravé ořechové. Ale co nějaká na vzduchu samovznítitelná kapalina, nebo míšení několika jinak samostatně nehořlavých kapalin? Nejsem bohužel chemik a moje znalosti chemie jsou méně než bídné, takže by se k tomu mohl vyjádřit někdo "od fochu" - chemik, pyrotechnik, terrorista apod. ne? Zajímavé je že se v souvislosti s draky a ohněm mluví často o síře...což ovšem zase klidně může být klasický křesťanský atribut pekla (a koneckonců křesťanský drak je vlastně vtělený ďábel - viz. apokalypsa sv. Jana).
argonantus3.3.2003 (17:20)
Darkelf (a taky Fanda:)
1) Takto definovaný úspěch je znakem všech tvorů, včetně draků, jednorožců a vůbec. Evoluce vede k účelnosti. Zda to platí i rpo temné elfy, to si nejsem jist. Pro beholdery spíš jo. Lidé ovšem podle mne někdy věří skutečně " jen tak", jak tvrdí nojon Džebe - jejich víra nemá s úspěchem nic společného (dokonce je zjevně vede do průseru, a oni to vědí).

2) Druhy draků - v mém světě (zhruba plán 3 reality) jsou draci přísně děleni podle šesti heraldických barev; drak růžový nebo fialový proto nejde. Nicméně někdy si pod vlivem různých racionalistů (jako Fanda) už nejsem jist, zda nejsou draci mimosystémoví. Například je prý drak podzemní, který má krátké drápy těsně za hlavou, připomínající krtka, jinak vypadá jako had a nelétá; a je dost hnusný; a dělá zemětřesení; nebo drak vodní. Ciruelo na to měl jiný názor (dělil draky na vodní, pozemní, zlaté a ještě nějaké ekologické prasárny na Sicílii).

3) To chrlení mi přijde jako příklad jakési fantastické maximalizace (podobně jako historka s jedem); když už je drak největší a nejdravější, proč by ještě nebyl plamenometný; v šedesátých letech by byl drak jistě i radioaktivní...
V každém případě si myslím, že jed předchází ohněstrůjné draky; a část je alchymické nedorozumění (viz úplný začátek debaty)

4) Bleskový dech?? Co je zas tohle?

5) Vnitřní dračí život vidíme trochu podobně; a dost mlhavě. Drak je původně mimo dobro a zlo. Je jaksi mimo naše starosti; myslí v mnohem delších rozměrech. není tak závislý na věcech a technice; vlastně skoro vůbec.

6) Svatý Jiří zabíjel draka, to je jednou jisté; a vrazil mu kopí do tlamy. Myslím, že velká většina vyobrazerní a soch míří k jedinému archetypálnímu obrazu. Jestli to byl skutečný drak (a ne symbol něčeho úplně jiného), kdy to přesně bylo a co se vlastně přesně stalo - to je jedno z největších tajemství
nojon Džebe3.3.2003 (17:41)
darkelf: Pokud by zvířata měla stejné schopnosti jako lidé s největší pravděpodobností by říše zvířat vypadala zcela odliště než tak, jak ji známe. Víra samozřejmě skončit nemusí - snad vždy se dá najít věc/bytost/ideál, v který dá věřit. Dle mého víra nemůže nikdy skončit, pouze zeslábnout. Toho psa bych viděl tak - pes vidí maso a nepřemýšlí jestli mu ho dáš nebo ne, zda si s ním jen hraješ nebo to myslíš vážně, prostě uvidí/ucítí maso, a tak za ním běží. Taky už jde o hraní se slovíčky - to, co jsem ted popsal si zase můžeš pojmenovat, že věří, stejně jako cokoli jiného. Ale otázku zvířecí psychiky bych už nechal příslušným odborníkům, kteří se tím zabývají a asi vědí oč jde. Ne, nepředpokládá, ale doufá ,či v to vkládá naději, což je, ač se to možná nezdá, něco jiného než, že předpokládá. Nemužeš označit víru v Boha a podobné věci za chuchvales prkotin - i když pokus o eliminaci tohoto faktu to je dobrý - nebot je to právě to, co nás liší od zvířat. Jinak ta myšlenka je pouze nesmrtelnost duše, ne fyzického těla. Jinak samozřejmě, že než člověk uvěří, automaticky o tom přemýšlí. Na kolik je to možné a další. Právě jsi dal příklad víry - pokud by člověk věděl, že něco takové není, přec VĚŘÍ, že to snad možné je. A v tom je krása víry.
nojon Džebe3.3.2003 (17:58)
Fanda: A někdo zasedá s jistotou, ale tohle nemá s vírou nic společného nebo spíš mi přijde nevhodně označovat slovem víra, šanci psa na to, že dostane maso. Víra je rozmanitá záležitost. Ale věc názoru - jedna divčina mi povídala, že věří v orgasmus.
Argonantus4.3.2003 (9:43)
nojon Džebe: vše podstatné je řečeno na fóru Bůh. Strukturujme debatu, přátelé; jinak zkomplikujeme život případným nově příchozím!
darkelf4.3.2003 (13:48)
Fanda:
Dík za podporu ohledně zvířat! Ale pokud jde o moji (nedokončenou teorii dračího dechu...ohledně mrazícího) nemůžeš zasse uvažovat v jiné rovině?! Proč by měli mít osstatní tvorové sstejné vlasstnossti, sstejnou sstrukturu a sstejné chování jako člověk? (to, že člověk je sstředem vessmíru sse assi nezbavím). Plicní epitel dračího dýchacího ússtrojí je vysstlán buňkami, které jssou chráněné vrsstvou, která je proti oxidaci ressisstentní a nessnadno tento plyn rozpouští!
Argonantus4.3.2003 (14:00)
Darkelf: naprosto souhlasím - člověk rozhodně není středem všehomíra, nýbž jedna z jeho celkem neparných součástí (dle některých dokonce nedopatření. Já bych snad tak daleko nešel).

A k tomu chrlení - začínám si myslet, že chrlení ohně se objevilo na scéně někdy v době okouzlení řeckým ohněm... jinak ta kyselina tu klidně mohla být dřív (pokud je čími neutralizována na pokožce draka... ha, mám tě, nevěřící Fando!!)

Ještě mi dlužíš bleskový dech, Darkelfe (3.3. v 17.20)! A taky klávesnici...
darkelf4.3.2003 (14:01)
Wothan: Zpětný ventil bymohla zajisstit hrtanová záklopka! Křessání jisskry o zuby bych ssi nevymysslel ani ve ssnu (i když..). Pssal jssem o enzymech, který by se vznítily při určité koncentraci kysslíku. Acytylen je tam jenom proto, aby něco mohlo oxidovat (bez něj byla moje první teorie, ale jakssi tohle posstrádala).
U těch kapalin nasstává otázka, za jak dlouho by sse drak vyčerpal (zássoby kapalin nejssou nekonečné a hlavně by každá mussela vznikat jinou cesstou). To by znamenalo, že by drak měl mít dva orgány, z kterých by tyto hořlavé látky zísskával (a to ze ssuroviny, která je na naši planetě nejdosstupnější - vzduch)! V tom sspočívá ta moje (kysslík tam je a acetylen by sse dal vyrobit z CO2). A na tom kysslíku to prosstě sstojím. Ale možná to bude i pověsstná dračí magie!
(jinak pokud chceš názor někoho od fochu.....4 roky střední chemárna a zatím necelé dva roky Biochemie na vejšce)! Jiank ss tím pyrotechnikem bych sse klidně u tebe podíval do zrcadla, že?
Ss tou ssírou máme na tuhle věc sstejný názor!
darkelf4.3.2003 (14:03)
K tobě jssem sse ještě nedosstal, zasse ssi píšem mezi prssty!
darkelf4.3.2003 (14:14)
Argonantus Všudypřítomný:

1) Tak posslední o víře a pak to píšu k bohovi! Ty lidi, co sse díky bohovi dosstali do průsseru to brali jako výhru ssvého já (a o těch jssem pssal jako o bláznech a pssychopatech. Ber to jako chybu z hranic normálu lidsství!)

2) Pouze šest heraldických barev? A to které? Jinak věřím v Krtkovitého draka (jesstli o tom Fanda pssal, tak máme sstejný názor). Ale u mě sse nejedná o draka přírodního z organické hmoty, ale o draka kamenného, diamantového. Je to ten tvor, díky jemu je podzemí tak rozssáhlé a sspletité! Co ssi mysslíš o kovových dracích (je to pouze díky lessku jejich šupin nebo doopravdy obssahují vzácné kovy)?

3) No můj názor znáš. Radioaktivita by byla pro draka, který b sse nezkládal ze sstabilních izotopů, poněkud ossudná!

4) O něm jssem sslyšel, že je to způssob útoku modrých draků. Originální a přírodě nejbližšší (i když v pozoruhodném provedení). Možná šlo o to pouze rozdělit bílé a modré draky!

5) No nějak tak! A požírá lidi:-)

6) Tak jo, tak ho assi zabil! Tak patří k těm, co sse zasloužili o jeho vymizení! Sshasshek jeden!
darkelf4.3.2003 (14:16)
nojon Džebe: Odpověd nalezneš u boha! (To zní dobře)
Argonantus4.3.2003 (14:38)
Darkelf neobyčejný:
Už jen k tomu, co zbývá:

2) Šest heraldických barev jsou červená, modrá, černá a zelená; a dva kovy, stříbro a zlato (švindlované žlutou a bílou). Tak platilo na počátku, okolo roku 1150, kdy si to někdo dost chytrý vymyslel - vše ostatní jsou novodobé prasárny (počínaje hnusy renesančními).

Už v souvislosti s tím mne taky napadlo, jak je to s těmi kovy v drakovi. A také s diamanty. Krystaly dávají jisou stabilitu... a člověk je plný různých kovů, například železa... v plánu 2 tomu dávám úplnou zelenou, v plánu 1 to může být částečná pravda (kov, zamíchaný do čehosi jiného; zvýšený obsah kovu v šupinách). Nevím; chemik nejsem.

4) Bleskově - modrý drak musí být elektrifikován. Originální nápad; dodej prameny, kdo to vymyslel; v přírodě elektrická zvířata prostě existují ( i Fandologicky, v plánu 1a). Možné důsledky jsou ohromující (pro mne jako pro mága - amatéra).

6) je to ještě složitější - myslím, že v Plánu 1 je Jiří (nebo jak se jmenoval) JEDINÝ případ, kdo draka úspěšně zabil, a všem ostatním to od té doby vrtá v hlavě. Jak k tomu došlo - záhada!
Fanda4.3.2003 (19:14)
Jen poznamenám, že elektrizující zvěř je vázána na vodu - tedy i elekrizující drak by musel být vodní - on totiž vzduch tak nějak špatně vede....
Wothan4.3.2003 (20:24)
A nebude probíjet?
Argonantus5.3.2003 (8:42)
Wothan a Fanda: To je fakt - elektrická zvířata (tuším sumec, úhoř a rejnok určitých druhů) jsou skutečně vodní; nikdy mne nenapadlo, zda probíjejí, když neútočí; tohle by vysvětlil asi lépe někdo z přírodovědně vzdělanějších, než já. Na vzduchu probíjí jistě méně, než ve vodě; a elektrický je právě proto, že může probíjet...
Pokud jsem dával pozor, Darkelf také mluvil o draku modrém, o kterém se tak nějak všeobecně předpokládá, že je vodní...

Všichni: musím uznat,že spousta věcí ohledně dračích dechů, které tu zazněly, mne nikdy nenapadly. Dech jedovatý nebo kyselinový (možná technicky lépe - jedovatá či kyselá slina) - jsou docela pochopitelné, už s ohledem na tu plivající kobru; s tím ohněm mám stále potíže; elektriku bych bral (souhlasím s Fandou, že spíš ve vodě - výboj ve vzduchu, který za něco stojí, je asi problém); a teď to mrazení, které slíbil Darkelf... bacha na něj, je to chemik...
Fanda5.3.2003 (12:15)
Ad elektřina: Ono se jedná buď o pozměněnou svalovou, nebo nervovou tkáň, takže je do kontrolované a tuším, že při větším výboji se musí i "dobíjet", ale tím si moc jistý nejsem. Dost těchle potvůrek to používá ke komunikaci a k orientaci - ono toho totiž ve vodách, kde žijí např. ti paúhoři toho doopravdy moc vidět není - konkrétně tito produkují vlastně 3 druhy pole - jedním se orientují, 2. komunikují mezi sebou, no a občas dají ránu, chtějí-li něco omráčit - někde jsem četl, že snad až 6000 V, nicméně na Ampéry to je slabé, takže rána sama se dá rozchodit... totiž rozplavat.
darkelf5.3.2003 (16:25)
Argonantuss:

včera jssem ssi vytáhl draky všech barev z materiálů, který mám sstažený z netů! A jejich teda požehnaně! Nepodle barev, ale i podle odsstínů. A těch různých věciček, co jim vypadává z huby (někteří prý zvrací lávu:-), jiní mají všechny druhy od kysseliny po oheň).
Kupodivu všichni považují modrého draka za tvora žijícího na pouštích (určitě je tam hodně nenápadný!), ale přessunout ho do vody by nebylo vůbec marný! Jinak podobnou obranu má i Bronzový drak, tentokráte velký milovník vody. Ssysstém by mohl fungovat jak to píše Fanda!

Kovový less nemussí mít jenom kovové látka. tady by totiž (pokud by to byli kovové šupiny) nasstal problém, kde by tento drak kov zísskával (jmenovitě zlatí draci). Protože druhou metodou by byla jaderná ssyntéza, ale radioaktivní draci? Zkussím to někdy najít.

Krysstaloví draci jssou podle mě ještě zajimavější než kovoví. Někteří tvrdí (očividně ovlivnění Hobitem), že když drak leží na ssvé hromádce drahokamů a ty potom, jak rosste, zarůsstají do jeho kůže. Sice tady už není problém ssuroviny zísskat, třeba sse potom vylučují jako odpadní látka, která na jejich kůži krysstalizuje!

(teď mě napadlo, rosstou draci až do ssvé ssmrti, nebo sse jejich růsst zasstaví........................a rosstou teplokrevní živočichové taky do ssvé ssmrti jako sstudenokrevní, nebo ne)

Ss tím mrazícím dechem ssi ještě budeš musset počkat, mám v tom hodně nejassnosstí (ale assi to bude zkapalněný plyn ze vzduchu)
argonantus5.3.2003 (18:02)
Darkelf a Fanda:
rochním se potěšením z vašich objevů...
Vrátím-li se k již skoro uzavřené základní otázce existence draků (28.2. ve 13.11),
pak obraz maníka, zasaženého elektrickou potvorou, když vlezl do vody, je opět tak úžasná, že vysvětluje určitě část dračí záhady (něco jako ta kostra sauropoda). A při tom to vypadalo s těmi blesky původně jako ptákovina... Darkelfe, moc prosím - kde jsi na to přišel? Co je nejstarší pramen bleskometných draků?

Samozřejmě, nikde není řečeno, že by draci vodní musili nutně létat; dokonce i bez ohně se obejdou. To je náznak Fandovy úvahy o více potvorách v základech celé dračí historie (to je zcela jasné v případě krokodýlů - např. brno - a hadů).
Nicméně, stále to ani v nejmenším nevyvrací můj dohad o létajících dracích (pokud je to ve vodě nebo je to velká kostra, není tu pražádný důvod, aby to létalo).Ale už s tím prozatím dám pokoj.

Ty krystaly na povrchu vypadají zajímavě; ona taková pitomá sůl to dokáže taky...
darkelf6.3.2003 (9:55)
Argonantus: modrého draka a blesskový dech ssem našel v AD&D (second edition), ale nemůžu ti říct určitě jesstli to bylo poprvé. Možná v Dragonlance byli modří draci, ale jakej měli dech, čert ví?
argonantus6.3.2003 (10:19)
Darkelf: Díky. Něco staršího by nebylo? (něco jako Wothan 25.2. v 11.25, blížší podrobnosti neříkám, neb čert a Ladýř nikdy nespí... mimochodem, začíná mne to docela bavit...)
darkelf6.3.2003 (10:33)
Argonantus: Wothan má k hisstorii trochu hodně blýž než já. Mrknu sse na netu, že?
darkelf6.3.2003 (12:24)
Argonantus: http://www.igolddragon.com (doufám, že tě potěší, alesspoň ten odkaz)
argonantus6.3.2003 (12:47)
Krásný odkaz, díky za všechny drakovědce, kteří na tohle fórum přijdou.
Mimochodem, ten Ciruelo a Montse Saint, co tam fungují - existuje od nich moc pěkná kniha o dracích v čestině (párkrát jsem to tady citoval).
darkelf6.3.2003 (12:52)
Argonantus: Tentokrát jssou blessky u žlutých draků (pouštních)
darkelf6.3.2003 (12:54)
omyl i u modrých
darkelf6.3.2003 (13:03)
Argonantus: zvláště http://www.colba.net/%7Etempest1/From_tail_to_snout/
argonantus6.3.2003 (13:20)
Taky hezký článek - trochu v duchu naší diskuse... tak nějak to asi mělo vypadat v Pevnosti č. 2.
darkelf7.3.2003 (13:46)
Argonantus: Vidíš, podkladů máš dosst, můžeš napssat nějaký článek o dracích a já sse zasse vrátím ke ssvým
argonantus7.3.2003 (13:55)
Darkelf: O článcích se právě jedná... tvé domovské doupě jsou "elfové"?
Měl jsem pocit, že jsi docela kosmopolita - i ve srovnání se mnou...
darkelf7.3.2003 (14:06)
Argonantus:
Jssem, ale pracuji na webu o temných a nějak to zadrhává z nedosstatku čassu, ssnad i prosstoru! A ještě k tomu řešit drakologii, která je podsstatně zajímavější, ale já chci prvně najít ssvoje kořeny,potom mohu hledat jiné! (to neznamená, že sse Draků vzdávám, ale já už doma překládám jedna radosst)
argonantus7.3.2003 (14:12)
Darkelf:
Vždyť se to netluče. Ještě neumíráme. Věřím, že světlo světa uvidí tvé pojednání o dracích, i o temných elfech...

A mimochodem, co jsi s tím začal, ti beholdeři mi nějak uvízli v hlavě. Něco na nich je. Možná o nich také něco zjistím...

Předpokládám, že narážíš na fórum "Dost bylo Pána prstenů", kde jsme se vzájemně údernicky povzbuzovali k statečné práci pro Pevnost...
darkelf7.3.2003 (14:17)
Argonantus:
Proto jssem nechtěl sstrašit, abychom neumřeli! Ale mysslím ssi, že ty by jssi měl pojednat o drocích, protože tvé duši jssou nejbližší!
Beholdeři, tajemní, krutí, bez boha...Co to znamená "V oku Beholdera?"..

Jo, tam jssem sse díval: chtěl jssem posslat pár obrázků do galerie, ale nevím jak.
argonantus7.3.2003 (14:22)
Darkelf:
Už tě zase přestávám stíhat.
Ale tohle je pro obecné blaho; na zmíněném fóru je mail Pavla Diviše - Divouse, kterému jsem napsal... mám rovněž řadu technických problémů - klidně bych pro Pevnost něco udělal, ale nevím jak... tak jsem se ho zeptal mailem... udělej to taky - třeba to bude fungovat (když napíšeš redakci, je to, jako bys to hodil do studny)
darkelf7.3.2003 (14:24)
Argonantus: teď je otázkou jesstli sse to z té sstudny vrátí? Ale čassém....
Wothan7.3.2003 (14:30)
Nevím co je Beholder, takže netuším co by mělo znamenat to rčení...
darkelf7.3.2003 (14:52)
Wothan: Tvor S jedním centrálním velkým okem a nekolika malými oky ne chapadlech rozmísstěných na kulovitém ssvalnatém těle (taková víceoká chobotnice).
Wothan7.3.2003 (14:58)
A to vzniklo jak? Z mythologie? beletrie?
darkelf7.3.2003 (15:02)
O tom nemám potuchy! Jesstli to má vůbec nějaký sstarý základ, možná je to pouze novodobá věc.
argonantus7.3.2003 (15:41)
Wothan a Darkelf:
Já teda nevím, ale beholder mne párkrát vošklivě sejmul v Might and Magic 7... a taky jsem z něj párkrát zešílel... bylo to v místech jménem Clankerova laboratoř a Hromová hora...
pak jsem na to zapomněl, až to na mne zase Darkelf tady vytáhl... nevím, co je beholder, ale asi je to pěkné nadělení...
existuje nějaká hra Eye of the Beholder... nebo je to kniha? Víc o jejich mytologii nevím.

Nicméně znám Cthulhu od Lovecrafta... a to je taky výtečná potvora. Takže nějaká tradice nebezpečných chobotnic asi je; v každém případě to má jakousi magickou sílu také.
argonantus9.3.2003 (15:25)
Všichni:
Ještě jednou k mé oblíbené vnitřní stránce draků - co se vám vybaví, když se řekne drak? Co cítíte? Co vnímáte?
Frelin9.3.2003 (22:25)
argonantus: Mě se vybaví moudrost a majestátnost a umění magie... A pak to že sou darci pěkný parchanti a žerou princezny... :))))) (To víš pohádka o Bajajovi je moje oblíbená) :))))))))))
darkelf10.3.2003 (11:46)
Argonantus: No tyhle beholdeři (v MM7) ještě nepředsstavují plnou ssílu jejich druhu. (jsou větší, tlusstčí a jejich magie je hrozivá)
Co je to Cthulhhu? Další Behold....?
darkelf10.3.2003 (11:48)
Frelin: JAko velký Trpasslík by jssi měl vědět, že draci princezny nejedí proto, že jim chutná, ale aby ssi přílákali mnohem massitější hrdiny!
Mě sse pod pojmem drak vybavuje Moudrosst, Sstáří, Volnosst, Neutralita, Sstrach i Štěsstí a nokonec obrovsská koncentrace magie.
argonantus10.3.2003 (11:53)
Darkelf:
erbovní strašidlo H.P.Lovecrafta, jednoho z velmistrů hororu a současníka Tolkiena. Vřele doporučuji Lovecraftovy povídky (vyšly tuším asi troje).

Cthulhu přišel z hvězd kdysi dávno... a vytvořil město R ´lyeh, které je plné podivné geometrie, ohromných nazelenalých kvádrů... a má tvar postavy s osmi rameny... je míli vysoký... a ty oči! Ty planoucí oči!!

Iá Cthullhu fthagn! Ve městě R´lyeh leží mrtvý snící Cthulhu!

(ještě se nebojíš?)
argonantus10.3.2003 (11:58)
Darkelf a Frelin:
k té asociaci... je to hrozně zvláštní, ale většině lidí se vybavují podobné věci... já vidím draky tak tak nějak - ohromná neutrální síla, která si dělá, co chce... a ta magie je tam určitě taky (pravá magie - žádné RPG modré blesky!!)... asi jako Niagarské vodopády... nebo jako manželka...
darkelf10.3.2003 (12:00)
Darkelf:
Základní tvar beholdera: ossm ramen, ossm očí a to jedno uprsstřed, tak kruté a krvelačné, ale i plné moudrossti a pochopení! Beholdeři taky přišli z jiného ssvěta k nám, ale nechtěli tu zůsstat, ale nešťasstnou náhodou jim nic nezbylo, a tak sse z nich sstali paranoidní ssamotáři. Ssnad Cthullhu je jejich ztracený bůh a ssní o návratu ssvých dětí.

Ne nebojím sse ho, je ssám a je mi ho líto! A to jssem Drow.
darkelf10.3.2003 (12:21)
Argonantus: Třeba jssou to sstrážci přírody, sschopny ničit její chyby!
Niagarsské vodopády, mno fuj, plně komereční ze špinavou vodou, to ssnad ne?! (manželku namám a tak nevím!
darkelf10.3.2003 (12:34)
Argonantus:Jé já to napssla ssobě, jak jssem ssobecký. Tak co, došlo ti něco z redakce?
argonantus10.3.2003 (12:48)
Darkelf znovu při chuti:
1) Podobnost beholdera a Cthulhu je čím dál tím zajímavější... ty jsi něco četl, co já ne - co je to? Moje zkušenost s beholdery je jen MM7 a také HoMaM, ale tam jsou ještě méně dramatičtí...

2) Niagarské vodopády (stejně jako všechny ostatní, pokud ti lépe sedí třeba Viktoriiny a Salto Angel, ostatně větší) tu byly dávno předtím, než komerce, Američani včetně Indiánů...

3) Manželka je něco, co stojí fakt zato (jak ti potvrdí každý, kdo se do něčeho podobného pustil) - asi jako drak, beholder nebo Bůh; když se to zvrtne, skončí to podobně...

4) Odpověděl mi Divous, velmi podrobně a přátelsky; teď s jeho návodem útočím přímo na Pevnost!
darkelf10.3.2003 (12:57)
Argonantus opět vždyzasstihnutelný:

1) Já je znám taky z Zapomenutých země, mé domoviny (Forgotten Realmss)
a tam jssou už pečení a vaření. Je pravdou, že nemají opravdového boha a někdy ssi na něj hrají (Baldurss Gate II - Kult nevidoucího Oka). Ale nic o nich bližšího Humáni, kteří píšou o našem ssvětě neví. A le mi, Temní, kteří žijeme jako ssoussedi ss nimi vpodzemí, známe jejich ssilné a sslabé sstránky. (V MM ssériích a v Homamech by byl ssilou na úrovni červeného draka)

2) Niagarsské vodopády jssou taky prudké a nesspoutané, ale za podmínky zničení ssvého okolí. Santo Angel by k přirovnání k Drakům byl šťasstnější.

3) Ale já zatím nevím o co jde, a díky Beholderům a Drakům za to!

4) Přeji dobrý útok......a napssal ti něco o vkládání obrázků?
argonantus10.3.2003 (13:03)
Darkelf:
3) Rozhodně neděkuj, protože když se to vyvede, je to stejně skvělé, jako draci, Bůh a beholder... nebo ještě mnohem lepší.

4) S obrázky mne moc nepotěšil... navrhhuje naskenovat jako JPEG ve vyšším rozlišení; případně, že on si to kreslí sám...
darkelf10.3.2003 (13:06)
Argonantus:
A když to mám nasskenované (lépe řečeno nakressléné na PC) a i ve velkém rozlišení, jak to tam mám dosstat?

Ty ssnad už jssi ženatý? Proboha!
argonantus10.3.2003 (13:11)
1) Pravděpodobně připojíš vzniklý JPEG patvar jako soubor k mailu, a necháš je, ať se s tím nějak utkají... pokud to chceš vydat v papírové verzi. Na internetovou se mne neptej, zdejší samoobsluhu jsem ještě nerozchodil (a taky tu ode mne ještě nikde nic nevisí...)

2) 16 let. Já tě varoval. Jsem zřejmě nejstarší ze všech tady (v Plánu 1, v těch ostatních jsem ovšem ještě daleko starší. Mladíku mi říkal naposledy král Vladislav, a to ještě zjevně omylem...)
Wothan10.3.2003 (13:15)
Tak starý nejsem ani já :-)
darkelf10.3.2003 (13:18)
argonantus:

ŠOK!!!

1) No já bych potřeboval internetovou ssamoobssluhu, ale assi tam budu musset napssat, že?!

2) A nebolí to! Naši jssou sspolu 21 let a sskřípe to všuhovšudy všude, takže mi děti trpíme, ale jssme dosst velicí, abych rozssévali zkázu v POdtemnu:-))) No mělo mě to napadnout, tolik vědomosstí a moudrossti. Klanim sse před tebou, sstarče, protože tvůj obraz mě nepředčil ani o jeden rok. Pohybují sse v iluzích tohoto ssvěta, zřejmě! (To neřeš, můj mozek to pochopil hned, ale moje já ss tím má problémy)! (No punková disskuze to opravdu není!)
Jak to, že tak dlouho zůsstává v tvé duši Dračí magie, já mysslel, že v tak technickém ssvětě to ani nelze?
argonantus10.3.2003 (13:19)
Wothan:
To já dávno vím, chlapče... ale jinak mi, Wothane, dlužíš ještě tu asociaci.
darkelf10.3.2003 (13:25)
Wothan: Takže sse tu přu ss dvojnássobnou moudrosstí?!
argonantus10.3.2003 (13:31)
Darkelf:
protože svět je mnohem barevnější a zajímavější, jak už jsem stařecky řekl (takže se nudně opakuji...)

Pokud ty ses mohl vyvinout od ministranta v temného elfa, pak dovol jiným, aby se vyvinuli z fandologického materialisty přes cynicky šklebného Darkelfa k trochu potrhlému mágovi, který nakonec shledal, že s realitou je to všechno trochu jinak, než mu tvrdili... je dost velký rozdíl mezi spojením jsem přesvědčen a přesvědčil jsem se...

vtip je v tom, že magie prostě existuje, všichni to mlčky uznávají a pracují s tím (více či méně dovedně), ale z jakýchsi důvodů (stud před Fandokraty?) se to stydí říct nahlas...
argonantus10.3.2003 (13:38)
nebo s dvojnásobnou senilitou...
darkelf10.3.2003 (13:39)
Argonantus:
Ano, tento důvod chápu, ale neznám mnoho lidí (prakticky žádného, a to znám širokou sspolečnosst od temnoty po ssvětlo), která by v tomhle vydržela. Doufám, že i mě tohle vydrží, doufám, že nesskončim jako řádový Humán bez fantassie a ideálů!

Můj vývin byl mnohem ssložitější než by sse zdál (jenom obyčejný přechod z dobra na zlo)....vyzkoušel jssme ssi prakticky všechno a zůsstávám u toho, co je mi ssrdci nejbližší a proto ti nechci brát tvůj ssen, i mě sse líbí a je jedním z nekrássnějších a endorfinem nejnabitější věcí, co znám!

Magie je, není pochyb, když může exisstovat jedenáct rozměrů vessmíru, proč by nemohla exisstovat magie!
argonantus10.3.2003 (13:49)
Darkelf:
Ostatně, názornou ukázkou praktické magie je tvoje překvapení před chvílí...
i to, že nás dračí kouzlo láká k tomu, abychom nad nimi bádali (i když trochu švindlujeme - odbočujeme jinam - ale i to patří k magii)

Vtip magie je v tom, že ji můžeš stokrát prohlásit za nevědeckou ptákovinu; že nelze úplně pochopit, jak funguje; ale potom se stejně staneš buď její obětí, anebo se o ni budeš pokoušet...
... a to zase stařecky odbočuji (neschopnost udržet myšlenku - J. Cimrman)
darkelf10.3.2003 (13:55)
Argonantus: Moje překvapení nebylo magické (alesspoň co ssi pod tím předsstavuji), nebojím sse moudrých, ale mám takový blbý pocit, že zísskávám poněkud větší odsstup. Poučovat sstarší sse přeci nehodí, i když.....
Draci mě lákají, to nepopírám, ale tak mě lákají i jené věci! Nejssem zatím ve věku, kdy sse fixuji na jednu věc, ssvět je pro mě prosstorový obraz, a proto ssnad lépe chápu chaoss... (taky odbočuju, co).
To je vtiv všeho, co neumíme dokázat!
argonantus10.3.2003 (14:08)
darkelf:
Já nevím, jestli se to hodí, nebo ne; žijeme v době, kdy je inzerovaná moudrost starců poměrně na prd. Zkušenost není posvátná kráva; spousta lidí něco dělá dvacet let, a při tom dvacet let úplně blbě.
Navíc zkušenost má smysl pouze v nějakém konkrétním kontextu; jak už jsem inzeroval, v případě Wothanova šermování projevuji nadšení dítěte, protože o tom vím přesně stejně. V případě draků je naše zkušenost všeobecně vetchá; nevidím důvod, proč bych se nenechal vzdělat od někoho, kdo vystudoval (narozdíl ode mne) něco přírodovědného. Jak říkám - s tou elektrikou například a s kostrou sauropoda se mi otevřely oči (v životě mne to nenapadlo).
Kromě toho, nevím, jestli sis toho Wothane všiml, ale v jistém smyslu zhruba od dvaceti let systematicky blbneme. Logické problémy už nikdy nebudeme řešit tak brilantně (ani kosmologické). Jediná naše výhoda je, že jsme toho snad víc přečetli (pokud jsme četli a pokud to umíme).
Mimochodem, co se týče problémů vedle, tedy Boha a kosmologie, podle Židů se začátek Genesis vůbec nemá číst před čtyřicítkou - a o nesplňuju ani já...
Jinak- asi se nikdo z nás nefixuje na jedinou ideu (taky by to byla dost otrava). Na druhé straně - zde jsou draci; tudíž nás k tomu fixuje neexistující procedura... a magie patří jinam...
darkelf10.3.2003 (14:18)
Argonantus:
Tahle doba je význačná dravosstí a nessmysslným nakládáním energie do toho, co náss sstejně jednou ssrazí do kolen a pak pochopíme, že ve sstáří sse některé věci už řešit nedají!
Ale já věku nerozumím, jssem příliš mladý i na to, že hrozně zírám, když sse někdo z mých známých ve dvaceti vdá! Ale i zkušenosst z toho, že je to blbě, dává poznatky mladším!

Moudrosst není inteligence. Moudrosst je o tom, jak dokážeme uplatnit ssvoje znalossti.


Zde jssou Draci
argonantus10.3.2003 (14:29)
Darkelf:

Naše doba je dost zběsilá, ale to mne nepřivádí k přesvědčení, že by nějaká jiná byla méně zběsilá... většina lidí moc nepřemýšlí (a pár jich přemýšlí až moc) - to bylo, jest a asi i bude.
Ve dvaceti brzo? Ani s tím si nejsem jist... ženil jsem se ve 22 (to bude tak nějak okolo tvého věku, ne?), a už ve dvaceti to bylo jasně rozhodnuté...
Kdo tvrdí, že rozumí věku, je blázen.

Tady jsou draci.
Wothane, co se ti vybaví, když se řekne drak? Mythologická bytost, nebo něco jiného?
darkelf10.3.2003 (14:31)
Wothan: NO! Co ty a Draci?
darkelf10.3.2003 (14:37)
Nic, tak sse mějte Pardi, já mussím jít na sseminář (kámoška mi nedonesla bábovku, búúú)
nojon Džebe10.3.2003 (15:09)
argonantus: Když se tu o tom už mluvilo. Neposlal by si mi ty podrobné instrukce od Divouse na mail poor_hero@centrum.cz. Budu ti vděčný.
argonantus11.3.2003 (8:34)

Nojon Džebe: úkol splněn, doufám.

Wothan: Co ty a draci - úkol trvá

Darkelf: K čemu taková temná mrcha potřebuje bábovku? A nepřeslechl jsem se, když jsem zahlédl něco jako ... city?
Wothan11.3.2003 (8:59)
Jste na mně zbytečně rychlí :-) No v prvním plánu se mi vybaví nějaký blíže neidentifikovatelný ještěr - spíše ale zvíře než co jiného. Je to zvláštní, protože mythologie je obvykle (ovšem také ne vždy) považuje za tvory inteligentní nebo jen za jednu z podob jiných bytostí (viz. třeba Fáfnir). A pak samozřejmě mythologická bytost - zase spíše ale v sekundární aplikaci - ve smyslu historických standart, znaků apod.
argonantus11.3.2003 (11:14)
Frelin,Wothan, Darkelf a všichni v pokusu s asociací:

Je nasnadě, že idea draka je v našich myslích zjevně zasažena tím, co do sebe cpeme nejčastěji a s největším nadšením; u Wothana jsou výraznější ty barevné korouhve, u Frelina Bajaja, u Darkelfa a u mne lze vysledovat i RPG hry, ať papírové, či počítačové... pak je tam někde určitě Tolkien; a jspousta dalších oblíbených knížek...

zajímavé mi na tom experimentu přijde určitá setrvalost těchto asociací; nejen, že se sobě dost podobají (ten neurčitý plaz, který se postupně konkretizuje, je výborný; tak nějak to je, jen mne to nenapadlo tak říci); jakoby kroužily kolem nějakého středu, drženy mytologickou gravitací (to jsem se zas rozkecal)...

Zvlášť divné je to, jak je ta idea vytrvalá i v čase. Když odečteme zjevně novodobé nánosy (větší důraz na magii a ohňostroje, i když i tohle v tom zárodku někde vězí), to, co zbyde, se nijak moc neliší od toho, co by si pomyslel nějaký vzdělanec okolo roku 1200...
darkelf11.3.2003 (13:04)
Dnesska tady vůbec nejssem, tak
Argonantus: Už ssem sse lek, že jí říkáš temmná mrcha...bych ssi tě assi napssal na ssvůj jídelníček. Ale došlo mi, že je to narážka na moji rassu! A líbí sse mi! Jssem temná mrcha, zní to tak hezky a proradně! Bábovky: jako jídlo ssamozřejmě, když mi někdo nabýdne nepohrdnu (Dávej, dokud beru:-)). To byl jenom pomíjivý a ironický ssmích, ss city to nic sspolečnéo nemělo, i když by sse můj příděl bábovek omezil, radosst bych z toho neměl!
Ten druhý výraz pro bábovky jako méněcenné druhy, ty nepotřebují, je to pouze krmení pro pavouky!
No u mě lásska k drakům, dalo by sse to tak nazvat, nevznikla nejen z RPG, ale i z velkému obdivu k dinossaurům, který však zanikl v raném věku!
Ale podobu draka mě dalo fantassy! (Sspíše u Tolkiena mě mrzelo, že tam tak málo o dracích a mlasskal u Dragolance, tam jich je víc než dosst!)

Draky bych považoval za velmi dokonalou předsstavu o těch, kteří tu byli před námi (doloženou dinossauří kosstí), je docela hezky vidět, že i v té době dokázali lidé ssi v hlavě dotvořit jejich tvar, který sse už moc nelišil od tvarů, které uznáváme dness.

Wothan: mussíme přiznat, že nejenčlověk je živ inteligencí:-)
argonantus11.3.2003 (13:25)
Darkelf nepřítomný:
nechtěl jsem psát, když tu nejseš... ale nějak mne to přenutilo (?); ostatně, já tu nebudu několik dní (zítra naposled)

Temná mrcha (podotýkám Moravská) patřilo samozřejmě tobě; nic jiného bych se neodvážil (sic mne stihne útok Temných, beholderů a všeličeho dalšího); a byl to obdivný výraz naivního dobráka...

Ale ti dinosauři... to je vlastně také dost důležité; neměl náhodou na oživení drakologie také vliv Jurský park a to třeštění okolo?
U mne draci hluboce předcházeli dinosaurům; začali někde u Bajaji, podobně jako u Frelina, pokračovali přes heraldiku jako u Wothana skoro současně přes Hobita... a pak nakonec přišel Turin Turambar s Glaurungem, a bylo rozhodnuto... tenhle asi nejsilnější zásah vedl k povídce, kde vznikl právě i Argonantus (pokud tě to zajímá, pošlu)
darkelf11.3.2003 (13:45)
Argonantus neodbytný:
(jak zítran napossled? Jako úplně, už umřeš, či co?) (aby jssi nenamítal na moje city)....jinak jssem dočetl ssthující odkazy na Bohovi, wow?

Temná mrcha sse mi líbí a ssnad sse i ujme, i když jssem ve zkrze prožraný dobrotou k lidem, které mám rád, ale ta druhá sstránka mě tolik láká k těm, které nenávidím?

Mě neovlivnil Jursský park, mě ovlivnil Zdeněk Burian a jeho obrázky a poprohlídnutí prvního mitologického draky bylo rozhodnuto! Jursský park nebyl až zass tak dobrý, aby něco obnovoval, byli tu i sstarší filmy, na který sse podívám radši, než an tu patlaninu ss genama (kterých mám někdy plný zuby)
Jisstě, že jssou draci sstarší, o tom žádná, dinossauři je jenom sslepá vývojová linie předurčena k vývoji ptáků :-) to nemysslím vážně( ale když ssi vezmeme éru člověka a éru brontossaurů, zpodivem ještě toho budem moc co dohánět!
Wothan11.3.2003 (14:11)
No někteří jsou pěkní ptáci už teď :-)
darkelf11.3.2003 (14:13)
Wothan: No nevím jak to mysslíš?

Argonantuss: pošli mi tu povídku, jesstli můžeš, rád ssi ji přečtu a můj mail (který sse tu nikdy neukáže, protože co den to jinej počítač)...darkelf@mail.muni.cz
Wothan11.3.2003 (15:44)
Parafrázuji tvůj výrok o tom že dynosauři byli slepou větví určenou k vývoji ptáků načež jsi porovnal dynosaury s člověkem....ergo zbytek je už jen logika :-)
Wothan11.3.2003 (15:48)
pardon...dinosaury
Fanda11.3.2003 (22:03)
Nějak se vám ta diskuse rozbředává...
A co máte kdo proti genům - kdyby Jurský park natočili před 50 lety, určitě by je nějak radioaktivně ozářili (a když si tak vzpomenu na Godzilu....)
argonantus12.3.2003 (9:01)
Re dinosauři:

Jo, jsme tu trochu off topic; určitě souhlasím s Fandou, že každá doba má své výkřiky (dokonce jsme už na stejném principu konstruovali radioaktivního draka); nicméně Crichtonova kniha je v zásadě naprosto výtečná (spolu s Koulí asi jeho nejlepší, pak už se spíš opakoval); hlavní myšlenky si nikdo moc nevšiml, a všem z toho uvízli v hlavě hlavně nějaké genové patlaniny.. a zbytek je prostě dračí kouzlo.

Tím se dostávám zpět na náš Rhodos. Archetypální scény s hrozbou sežrání, něčeho velice starožitného a málem zapomenutého, k drakům určitě patří... myslím, že neinformovaný divák (filmu) si pamatuje hlavně na tyranosaura s džípem... a snad ty velociraptory... Spielberg si vypůjčoval určitě ze svých vlastních Čelistí (ty jsou zcela a úplně o tomhle), ale je také možné, že ten tyranosaurus vznikl zčásti z nějaké pohádky, která mu uvízla v hlavě...
... například, pamatujete, jak duní země, když se tyranosaurus blíží? Mně se to velice líbilo; v pozadí ale je nějaký mýtus, protože technicky je to blbost...
darkelf12.3.2003 (13:36)
Argonantus:
Díky za povídku (v průběhu víkendu ssi ji přečtu, sslibuji)
Omlovám sse, že je mi z genů na ..., ale vy sse tohle nemussíte učit.
Archetyp draka? To je dobrá otázka? Jak vypadal první drak (né had, né ještěrka?)
argonantus12.3.2003 (13:45)
Darkelf:
jsi přesycen genetikou, jako jsme přecpáni Pánem prstenů, a jako jsme kdysi šíleli nad radioaktivitou...
archetypem jsem myslel nikoli draka (to bychom se vrátili někam na začátek debaty), ale archetyp sežrání...

necítíš zvláštní působivost toho, že tě prostě nějaká potvora slupne, zblajzne, zbaští? Kdysi dávno se lidem takové věci stávaly... od dob vyvraždění medvědů v čechách se to nemůže stát našinci skoro ani teoreticky (já vím, když uprchne lev ze zoo a když pojedu na Floridu k moři...)
přesto je sežrání čímsi fascinující a působivé i dnes... takže možná to souvisí i s Jonášem a velrybou (proč by jinak tahle epizoda byla takový trhák? čím jiným zastiňuje Jonáš deset dalších proroků okolo?)
darkelf12.3.2003 (13:55)
Argonantus:
Kdyssi sávno jssem četl o nějakých výzkumech toho, co cítí myš, když ji požírá kočka. A ssvěte div sse, je to sslasst. Když organissmuss takto umírá, mozek reaguje na příliš vyssokou aktivitu nervových buněk ničím lepším a dokonalejším, než je endorfinem. A ta myš ho tedy má v těle hodně? Co ty na to! (a když jssi zraněný, můžu potvrdit z vlasstní zkušenossti, opravdová bolesst sse dosstaví třeba až druhý den!)
Wothan12.3.2003 (14:35)
Napadlo mne....jak by jste popsali nějakým hodně primitivním jazykem za pomocí příměrů vzdušný vír - tornádo?
argonantus12.3.2003 (14:35)
Darkelf:
je to nějaká mazaná chemie, vysloveně prodracká.
darkelf12.3.2003 (14:42)
Wothan: Cože? Primitivním jazykem tornádo. Cessta do nebess?
argonantus12.3.2003 (14:43)
Wothan:
příšerně těžká vychytávka. Kdosi kdesi tvrdil, že tornádo je v Kosmově kronice - musím se tam podívat, kde to je a jak to vypadá...

jinak pokud vím, u složitých věcí se velmi často pustili autoři do personifikace (viz ty planety, Bůh jakožto dědeček a tak...)
darkelf12.3.2003 (14:45)
argonantus: není to proradná chemie, ta mě připadá v celku logická! Proč by měla ssmrt bolet?
argonantus12.3.2003 (14:49)
darkelf:

pozor - pustil ses najednou zase na pole dobroty Boží...! Jak tě chvilku nehlídám... jak efektní prowothanovský argument!

Obrátím tvoji otázku - proč by smrt měla být milosrdná?
Smrt je konec života - z hlediska přírody není zřejmě vůbec žádný důvod, aby tam nějaké podobné "anestetické" opatření bylo... proč by měla být příroda milosrdná, kdyby nebyla dána jakýmsi duchem... vědomím...?
darkelf12.3.2003 (14:55)
Argonantus: Tyss mě nepochopil! Já to nemysslím z boží dobročinossti, ale třeba ssmrt není tak špatná. Třeby process umírání je uloženo v genech (trovhu mimo tvoji míssu) a je vylepšena natolik, že je to ten nejssladší orgassmuss na ssvětě. Nesslyšel jssi o tom, jak sse v anglii děti věšeli na provaz (a osstaní jim hlídali čass) a potom říkali, že je to lepší než heroin! Ssmrt tedy bude to nejssladší v našem životě! Posslední dávka endorfinu!
Wothan12.3.2003 (15:20)
Argonaut: ano je, četl jsem to - pochopitelně překlad, protože neumím latinsky, ale nejsem si bohužel v tuto chvíli jist k jakému roku se to váže...to je důležité pro to jestli to je ještě vůbec Kosmas nebo už jeho následovníci. Mám obojí, jen se mi to bude pomaleji hledat, protože je pořád ještě snazší prolistovat to všechno než se prokousat stohem mých zápisků, výpisků a poznámek ačkoli jsem si bezpečně jistý, že tohle jsem si vypsal.
Wothan12.3.2003 (15:23)
Argonaut: nicméně elegantně jste se vyhli, oba, té personifikaci do které jsem vás tlačil...nechtěl jsem napsat doslova "personifikujte"...ale dobrá, už to sice není ono, ale tedy personifikujte :-)
darkelf12.3.2003 (15:26)
Wothan: Tak nějaká chuťovka pro tebe. Co je to teplota? Nepotřebuješ na to být primitivní, abyss to nedokázal říct!
argonantus12.3.2003 (15:29)
Wothan:
a ako sa to váže k drakom?

Darkelf:
já fakt nevím... tahle zkušenost mi jaksi chybí; smrt plánuji na rok 2066 (respektive poradu s manželkou, co dál); možná že to bude orgasmus... to by nám asi lépe objasnila ta slečna, co agitovala nojona Džebe (mimochodem, tady by se určitě uplatnila, alespoň v teoretické rovině...!)

nicméně o jakémsi podobném efektu jsem skutečně slyšel jednak v souvislosti s tím oběšením, jednak v souvislosti se žraločími útoky (a to už jsme těsně vedle draků), jednak v souvislosti s Moodym (a to se zase vzdalujeme...)
řadím to do celé řady věcí, které tak nějak nedovedu vysvětlit (jako třeba, proč se rodí na světě zhruba stejně samců, jako samic; proč jsou kytky zelené; proč je v noci tma; a konečně, ak to bylo s tím svatým Jiřím...)
argonantus12.3.2003 (15:39)
Wothan:
Jéžiš, to je zas bordel; ještě,že tu delší dobu nebudu, aby se to tu uklidilo a pozapomínalo...

personifikované tornádo?
No, mně naskočí uplně takový ten bílý maník, co je v Might and Magic 7 coby živel vzduchu... má založené ruce, nohy neurčitě mrakovité (spíše ne, než jo), celý je tak trochu průsvitný, když do něj bacím, tak od něj odletují jakési kapky (mráčky?), a celý je tak nějak rotačně symerický...
darkelf12.3.2003 (15:43)
Argonantus:
Samci prý za pět milionů let vyhynout. Není co řešit, ne!
Ale tahle odpověď je kvůli tvé fasscinaci tím být ssežrán!

Tak nahoď něco o dracích?

Mysslíš vzdušný element? Ne? Nebo jak sse jemnoval a lítal tam po poušti!

(na jak dlouho odcházíš?)
Wothan12.3.2003 (15:47)
Argonaut: je to had. Zdaleka ne všechny tornáda mají podobu širokého pravidelného víru, mnohem častější je (pokud je to vůbec vidět) spíš úzký pokroucený....letící had.
darkelf12.3.2003 (15:49)
Wothan: Ta teplota?
argonantus12.3.2003 (15:50)

Stále ještě dychtivě čekám, kam nás Wothan s tou personifikací zatáhne...

(v úterý si mne zase užiješ k plné hrůze, nebreč...)
Wothan12.3.2003 (15:58)
Teplota je fyzikální veličina, stejně jako tlak, vlhkost...co s ní? Pokud chceš argumentovat tím, že ji nevidím a přesto věřím že existuje, doplnil bych že ji cítím na kůži (jako změnu) a dá se definovat (i když zase jen nepřímo).
darkelf12.3.2003 (15:59)
Wothan: Tak to chceš vyssvětlit malýmu dítěti, jo? Je to veličina......
darkelf12.3.2003 (16:00)
Wothan: Tornádo a had? Jesst možno, proč by ne!
Wothan12.3.2003 (16:01)
Malýmu dítěti položím ruku na kamna a pak jí strčím do lednice :-) Pravdou je, že na to abych to mohl popsat někomu kdo o tom nic neví (což předpokládá že by byl uzavřen v nějaké sterilní baňce) a neměl osobní zkušenost - v tomhle případě se změnou - nepoznal nikdy chlad ani teplo bych to pouze slovy vysvětlit nedokázal.
darkelf12.3.2003 (16:08)
Wothan: originální nápad a už nejssi moc daleko. No nic, jen ssem tě zkoušel. Jinak teplota je směr toku energie. Pak už sse dá rukama a nohama vyssvětlit.
argonantus12.3.2003 (16:10)
Svět je plný věcí, co existujou v plánu 1, ale pro naše smysly jsou jaksi nedostupné... a tím hůř popsatelné:
ta neutrina; barva, vůně a půvab kvarků; argon;
uniká mi, co z toho plyne a co se tím dokazuje...
Wothan12.3.2003 (16:12)
No pánové, pro dnešek mne těšilo...pohlavkuju se za tu energii - mohl jsem si to odvodit ze své vlastní mnemotechnické pomůcky...to mám z toho že už jsem tu dneska dávno neměl být, ale sedět v hospodě a probírat rozvržení plakátů k římanům - bye.
darkelf12.3.2003 (16:13)
Argonantus: Jen ssem váss chtěl potrápit, Filossofové!
Fanda12.3.2003 (16:15)
Tak Argonante, na ty první otázky bych ti i dokázal odpovědět, ale s draky to nemá nic co společného.
Apropo tornáda - jsou pocjopitelně i v Evropě, akorát povětšinou v oblastech neobydlených (Skandinávie) a netrvají tak dlouho, ale pokud sledujete dění, tak jdou už i k nám, nebo se vrací?
argonantus12.3.2003 (16:22)
Fanda:

to jsi fakt dobrej (zvlášť, když víš, jak to bylo se svatým Jiřím..)

docela by mne zajímala ta asociace i u tebe (pro přehlednost - co si vybavíš, když se řekne drak?)

tornáda se nevracejí; nikdy odtud neodešla... a že by další teorie vzniku draků? No, já nevím... přece jen to vypadá dost jinak... i když ty planety...
Wothan13.3.2003 (8:21)
Argonaut: někdo jste se tu ptal na letícího hada - proč by měl létat zrovna had a ne slon - tornádo by mohlo být odpovědí. Skutečně doporučuji se nad tím zamyslet a projít si pár fotek a záběrů tornád.
darkelf13.3.2003 (9:16)
Wothan: Sslony jssme řešily. Ganéša je taky z nebess!
darkelf13.3.2003 (9:16)
Všem: Trochu mimo.....jak bysste pojmenovali Great Wyrm.....nejsstarší a největší sstaádium draka....viděl jssem překlad jako Velký červ, ale není to příliš potupné pro draky?
S.U.P.13.3.2003 (9:24)
No velky červ není moc pěkné.

Draci jsou přeci taková královská stvoření (zvířaty se nedají ani pojmenovat), jsou přeci takový hrdí. A myslím si, že k tomu mají důvod. Takové velké a inteligentní stvoření vzbuzuje úctu už pří pohledu nebo ne?
Wothan13.3.2003 (10:13)
Vyhodit dovzduchu slona představuje buď opravdu velkou protiváhu, nebo spoustu dynamitu...vrh hadem by byl asi jednodušší. Gaméša je samozřejmě bůh a bohové jsou bohové, zvláště stran vlastností, bez ohledu na tvar. Drak je svébytná mythologická postava, to bych nesrovnával. Ale to tornádo by bylo hadem, červem...je to jeden z mála přírodních úkazů který opticky připomíná létajícího hada, navíc budí respekt, má ničivou sílu, je dostatečně velký...
darkelf13.3.2003 (10:17)
Wohan: On taky velmi dlouhý mrak připomíná hada? Ale mysslíš, že byli v Evropě tak časstý tornáda?
Wothan13.3.2003 (10:43)
Nevím jak časté jsou v Evropě, vím jen že jsou doložené i u nás. Zajímavější je že jsou doložené s větší nebo menší intenzitou skoro po celém světě. Mraky jsou ale běžné útvary (i když některé skutečně překvapí) - tornádo ani tam kde je to častý jev tak úplně běžný úkaz není, navíc mrak není nebezpečný - jistě že se jej můžeš bát, ale tornáda v sousedství se prostě bát musíš. Pokud bych popustil uzdu fantasii - mnohem spíš bych vytvořil strašlivého, nebezpečného létajícího hada z tornáda než z nějakého mraku. Mýty stojí na víře - i kdyby tu první věc na které mýtus stojí (stejně jako křesťanské legendy) viděl jen jeden člověk, nebo jen pár lidí, i kdyby to jen špatně intepretoval či popustil uzdu fantasii (to je ta otázka vysvětlení si jevu personifikací...teď podotýkám ale nemluvím o bozích) může nevědomě vytvořit mýtus "strašlivého létajícího hada" - i lidé kteří jej nikdy neuvidí v něj budou věřit a budou jej popisovat. Pokud víš co to dovede, stačí ti někdy i jen nacházet stopy po tomhle živlu - skutečné i domělé, pak poslouží zase jako důkaz jeho přítomnosti. Myslím že na to aby se z tornáda stal mýtický had stačí překvapivě málo i když s dnešním způsobem myšlení (to není jen o informacích, to je o celkovém způsobu myšlení a uvažování) nám podoný přístup může připadat naivní, nesmyslný, možná i hloupý.
S.U.P.13.3.2003 (13:50)
A co teprve když takové tornádo vidíte v nocí?

Takový kus pěkně záživých šatů v reji tornára může někomu připadat jako oheň a pak už je jen kousek k zuřivému draku. Je vcelku jasné že takového tornáda si určitě všimne více lidí no už kvůli tomu hluku co nadělá ...... No a pak není o svědky nouze.
Fanda13.3.2003 (17:13)
Argonantus: První 2 chtěl jsem napsat...

A jinak nutno dát za pravdu Wothanovi a pamatovat na to, že i naši předci měli nějakou fantazii a řekl bych, že i stejně dobrou, jako máme my teď. Fantasii, která dokáže přirovnat vířivý proud vzduchu k hadovi - nemyslíte si, že tím, že když víru v draky budeme vykládat jejich existencí, budeme našim předkům ubírat schopnost snění a fantazie?
darkelf14.3.2003 (14:01)
Wothan:
Pokud v naší již tak hromadně zalessněné zemi sse vysskytovala tornáda, budiž! Ale zatím dossud jssem nesslyšel o tom, že by sse vytvářeli tornáda na d lessy?! Na vyprahlých pouštích a možná nad velkými lány (příklad tornádo od Znojma) jo, ale nad lessy? Možná by musselo být ohromné horko. Může předsstavovat létajícího hada? Ale proč sse nezachovali zmínky o obrovitých létajícíhc hadech u náss. Přece jenom tu máme poněkud ještěrkovitější draky než například v Číně (a výsskyt létajícíhc hadů v sseverní Americe.....tam jssi sse assi trefil)! Ale já nemám takové hisstorické znalossti jako ty!

Jinak moje otázka trvá: Jak by jsste nazvali jinka ten příšerný překlad Velký červ pro Great Wyrm?
Wothan14.3.2003 (14:34)
Tak to nevím - ze starších hist. pramenů je doloženo pouze jedno tornádo a to z Prahy a nemluví se tam přímo o hadu ani jiné personofikaci, ale o větru jako živlu. Já to dohledám, zatím jsem to ještě nenašel - nebyl čas.
Fanda14.3.2003 (14:37)
2 Darkelf: Velký had? ..... nebo velká žížala ^__^
darkelf14.3.2003 (15:57)
Fanda: Já mysslel něco co se k drakum hodí? velký had ani velká žížala nevisstihuje význam Great Wyrm!
Fanda14.3.2003 (23:11)
Tak v tom případě asi jenom velký drak...
argonantus17.3.2003 (10:29)
Ad tornádo:
vidím, že Wothan tuhle věc docela slušně rozpumprlíkoval... na začátku byl Frelinův dotaz z 26.2., a moje nepřesná odpověď z 27.2. ("bylo viděti létati hada.")
Procházím pokračování Kosmovo, a zjišťuji, že to neřekl kanovník Vyšehradský, nýbrž mnich Sázavský, a to roku 1142, v jediném odstavci, popisujícím požár v Praze (takže nás nechává v nádherné nejistotě, zda to souvisí s tím požárem, nebo je to samostatná událost.)

Poznámka pro nečtenáře Pokračování (Wothane, omlouvám se) - Kosmas umřel asi 1126, a po něm pokračovali nezávisle na sobě tihle dva maníci (mnich Sázavský a kanovník Vyšehradský) až do krále Vladislava (1140-72), kde k nim přistoupil ještě Vincencius. Co neví tihle tři o této době, nevíme skoro vůbec.

Kanovník Vyšehradský sice nepíše o hadovi, ale je daleko zajímavější v tom, že se přímo specializuje na prapodivné nebeské úkazy (dnes bychom je klasifikovali jako UFO). Z jeho doby skoro nemine událost, aby si nepřipravil nějakou bizarní přírodovědnou vychytávku (biskup málem zabit v Chuchli kamenem, který se svalil ze svahu a prorazil dům... nebo také, Fando a Wothane, poslouchejte - bylo viděti úkaz, podobný DRAKOVI...)
Problém s tím tornádem bude asi v tom, že to slovo se pochopitelně v tehdejší řeči nevyskytuje... takže lze za tornádo prohlásit s určitou mírou nejistoty různá UFa kanovníka Vyšehradského...

Jinak k četnosti tornád - loni jsem viděl tornádo na TV Nova natočené někde na Olomoucku... takže nad lesy asi ne, nicméně dost místa na tornádo bylo v Čechách a na Moravě zřejmě už asi dávno...

Já fakt nevím. Teorie draka coby tornáda může být přiřazena jako jeden ze zdrojů mýtu, podobně jako ta kostra a elektrická potvora... myslím ale, že mi stále ještě něco podstatného uniká. Drak je tak nějak ještě něco trochu jiného.

Ad Great Wyrm: Co "Velký plaz"? Nebo rovnou Veleplaz?
Jinak tahle "červovitě - hadovitá" tradice je možná stejně nepřehledná, jako létající draci, zvláš´t, když se do toho zamotají vodní Krakeni.. Glaurung byl ostatně také tento typ.

Uf.
darkelf17.3.2003 (11:35)
Fanda: Velký drak je great dragon a ten pak rosste a rosste až z něj vyrosste....
darkelf17.3.2003 (11:35)
Argonantus: Veledrak, no jó!

Teď malá, ale prosstá otázka: Byli draci už mýtickou posstavou ve sstředověku?

Jinak četl jssem tvoji povídku. Chápu Argonanta (není ssám on nakonec drakem? možná). Pak také chápeš to, že draci už dávno zjisstili, že lidé nepřinášejí i přes všechnu jejich pomoc, přírodě užitek. A proto je nenávidí!
argonantus17.3.2003 (12:11)
darkelf:
mýtus ve středověku - kdybys dával pozor, všiml by sis, že o tom Divous napsal do Pevnosti v jistém smyslu článek (heraldickém), a Wothan skoro o ničem jiném na tohle fóru nemluví...
jistěže ano - a dokonce už ve starověku (minimálně v Řecku, Číně a u Keltů). Dokonce v naší části světa už s tím slovem (Dragon, draco, drake a tak nějak...)
darkelf17.3.2003 (12:14)
Argonantus: Je toho tolik, jen sse ptám! Je toho na mě moc myšlenky nesstíhají. Ale bral člověk sstředověký draka jako to, co může někdy potkat v reálu (věřil v jeho exisstenci)?
argonantus17.3.2003 (12:35)
Darkelf:
Podle mne ho o tom vůbec nenapadlo zapochybovat. Pokud budu mít štěstí, najdu někde přírodovědný popis nějakého vědce, dokonce z doby ještě renesanční, ne-li barokní....
jak říkám, lidi o dracích nikdy nepochybovali, až do francouzské revoluce - a hned brzy nato vypukli dinosauři...

Napadlo tě někdy, jak velké procento věcí, o kterých "víš", jsi nikdy v životě neviděl, nýbrž ti o nich jenom řekli?
Celý náš "objektivní" svět je jedna velká vratká konstrukce...
darkelf17.3.2003 (12:38)
Argonantus:
Ućím sse chemii a v životě jssem viděl pouze jenom jeden atom. Ssvět je pouhá konsstrukce, máš opět pravdu.
Je tedy Argonantuss drak nebo není?
argonantus17.3.2003 (12:43)
Darkelf:
Kdo je Argonantus, to mi přišla trochu sebstředná otázka... a navíc jsem to v době psaní povídky neměl až tak úplně vyřešené (Argonanta jsem odložil, a te´d mi přišel vhod).
Teď se mi to jeví následovně:
Argonantus je maník, který se zdržuje poblíž vchodu do Chrámu. Protože nahlíží dovnitř, ohromuje ty venku kouzly, která tam odkoukal; jim to připadá důmyslné a on se jeví jako velký machr; na druhou stranu ho také občas (právem) podezírají, že toho zneužívá, švindluje a podvádí; konečně, on sám dobře ví, že ta kouzla nejsou jeho; a že jsou ničím proti tomu, co zahlédl uvnitř...
takže daleko spíše dračí služebník, než drak samotný.
Divous17.3.2003 (12:45)
DARKELF nestíhám tuto debatu číst celou takže mi možná něco uniklo....proto se ptám: To tvoje zdvojené "Ss" v každém slově se "s" má nějaký objektivní důvod ? Nebo jen vyjadřuješ svojí originální osobnost ? Já jen že to působí hodně trapně
darkelf17.3.2003 (12:45)
Argonantus: I draci sslouží drakům!
darkelf17.3.2003 (12:50)
Divouss: zdvojené ss sse používalo ještě před ssto lety. Ale abych uklidnil tvou duši, zdvojené ss je z Drowího jazyka. Jakkákoliv podobnosst (pokud ta trapnosst je myšlena na narážku (ss...jako nácků) můži ti z klidnou duší oznámit, že tomu tak není a ani já ssám (založením antifašissta, jak duší a tělem) nemám ss tímhle nic sspolečného. Nenaznačuje originální ossobu, naznačuje Drow.
Pokud sse ti to zdá trapné z jiného důvodu, můžeš důvod hledat ve ssvé přeedssíni cannali annaliss!
Divous17.3.2003 (12:54)
A co je to Drowí jazyk ? Já jen , že s podobným stylem psané sebeprezentace jsem se už občas na i-netu setkal, ale nikdy se nejednalo o vyzrále osobnosti....spíše o tápající mladíky ;-)
No ale neber to osbně
darkelf17.3.2003 (12:57)
Divous: a víš vůbec kdo jssou Drow?
Wothan17.3.2003 (13:31)
Darkelf: mně by se to taky četlo líp česky :-)
darkelf17.3.2003 (13:36)
Wothan: Tak ssi zvykej!
Wothan17.3.2003 (13:52)
A nechtěl bys psát třeba polsky?
darkelf17.3.2003 (14:25)
Wothan: Jesstli sse ti to nelíbí, sstrč ssi ssvoji cenzuru moji ossobnossti za zadkovou výsstelku ssvého brnění, jo!
argonantus17.3.2003 (14:26)
double ss:
Mně tohle vůbec nevzrušuje; různí lidi psali v různých dobách různé ujetosti (Římani psali V místo U, prý proto, že se jim to líp sekalo do šutru; kdoví, jestli něchtěli být jenom zajímaví?)
Divousi, nebuď tak akurátní, radši pozri, čo to elfisko tlachá... třeba na Bé na počátku...

Osobně jsem ve Forgotten Realms i v Dragonlance úplný mimoň, takže se rád vzdělám...
darkelf17.3.2003 (14:29)
Argonantus: Dík
Wothan17.3.2003 (14:30)
Argonautus: být zajímaví...to jako že chtěli udělat dojem na Řeky? (ehmm...) nebo na barbary? (ano...takový Ambiorix skutečně uznale pokýval hlavou když zmasakroval Cottovy legie a našel nějaké ty psané záznamy...hle, tohle V vypadá skutečně vznosně!) :-))

Darkelf: mně je jedno jak píšeš, jen to většině lidí poněkud znesnadňuje čtení (i když uznávám že ta polština by byla asi ještě horší)....tedy pokud si to nepíšeš jen z čirého plezíru něco si jen tak napsat, ale sděluješ informaci.
darkelf17.3.2003 (14:33)
Wothan: No nic, ale vyloženě jsste ěm tím nassr.....
Wothan17.3.2003 (14:35)
Darkelf: rádo se stalo, jen aby ti to nezůstalo i v běžném písemném styku...v oficiálních lejstrech se to asi vyjímá dost blbě ne? :-)
argonantus17.3.2003 (14:49)
Wothan a Darkelf a Divous:

právě v oficiálním písemném styku bych takovou věc ocenil!!
Nevěřili byste, jak se lidé snadno schovávají za "správně provedenou úřední formu", při čemž tím pouze zakrývají úžasnou vnitřní prázdnotu.
Wothan17.3.2003 (15:41)
Můj styl psaní oficiální korespondence je už natolik vytříbený, že jsem vyrazil omluvu a 78,-Kč i z ředitelství pošt, když ošulili mojí ženu na balíku...je to zanedbatelná částka, ale po argumentaci úředníků na přepážce si to člověk vezme osobně :-)) Jo každodenní korespondence s dodavateli a odběrateli je zajímavá škola praxe.
darkelf17.3.2003 (16:22)
Tak já zkussím něco najít o dracích abychom posskočily (komu sse to špatně čtě, ať nássilně zkříží oční bulvy do tvaru keltsského kříže a sstředem vysstrčí ssvůj noss)
argonantus18.3.2003 (9:00)
Vraťme se k drakům.
Takže pro labužníky historických UFO tentokrát celý citát - kanovník Vyšehradský, rok 1130, na konci dlouhé politické historie praví:
"téhož roku dne 8. října jednu chvíli, totiž při západu slunce, bylo viděti jakousi obludu, draku podobnou, jak letí přes celé Čechy i přes mnoho jiných míst. Potom však mnozí viděli jiné znamení, velmi jasné, v jitřní hodinu."

K tomu je třeba si uvědomit, že učený kanovník byl jedním z mála lidí v nevelké a nepíliš významné zemi, kteří dovedli psát; přesto nejasný úkaz přirovnává k draku jako k věci známé.
To je zároveň odpověd na Darkelfovu otázku, jak se dívali na draky ve středověku.
darkelf18.3.2003 (12:59)
Co takhle dračí kultura a její předávání mladším generacím?
argonantus18.3.2003 (13:29)
Darkelf:

To už jsi zase v mém světě, ne v plánu 2. Nicméně si myslím, že pokud by draci byli dlouhověcí, měli by zkrátka na všechno strašně moc času... dětství by nebylo jasně ohraničené, ale takový drak by se vlastně učil neustále... stejně jako plazi neustále rostou... v tom případě by stáří draka mělo skutečně jasný společenský význam...
darkelf18.3.2003 (13:31)
Argonantus: Ale určité předávání ssvé kultury by tu mělo být! draci nejssou nessmrtelní a dětsství prožívají určitě!
darkelf18.3.2003 (13:43)
Argonantus: (add beholdeři) Tak ssem sse díval na jednu sstránku, ono doopravdy Oko zla (assi behold) má více než bohaté mytologické kořeny!
argonantus18.3.2003 (13:47)
Určitě ano. Jenomže když to předávání trvá desítky, nebo dokonce stovky let... na počáku je svět jiný, než na konci... nejsem si právě jist, zda za takových okolností má ještě pojem "dětství" nějaký smysl. To se ostatně děje dnes s celou lidskou civilizací také - nikoli dlouhověkostí lidí, ale zrychlením času.
darkelf18.3.2003 (13:50)
Argonantus: No ale pokud sse jedná o moudrosst tak sstarobylou, jakou je dračí magie, tak..
...dětsství pořád exisstuje, věřím v něj, ale civilizace začíná pro něj udává někdy příliš malý čass. Ve sstředověku to bylo ale horší, ne!
argonantus18.3.2003 (14:01)
Darkelf:
Tohle zase zajímá mne... je to další uhranutí; co si ti lidé ve středověku mysleli doopravdy. Totiž ti, co vůbec mysleli - velká většina lidí všech věků moc nemyslí...
Dříve jsem pod vlivem všeho možného předpokládal, že byli v určitém napětí a strachu před nesčetnými hrůzami... dnes už si to myslím stále méně. Jejich svět jim zřejmě nepřipadal o nic hrůznější, ani méně hrůzný, než náš.
Dětství měli asi jasněji vymezené... těžko se mohlo stát, že by syn uměl něco lépe, než otec; to je dnes běžná zkušenost...
darkelf18.3.2003 (14:08)
Argonantus:Nevím co ssi lidi myssleli ve sstředověku, ale i já, neznalý ssvěta kolem mě ssem sse hrozně bál (a to teda hodně moc), ale čassem sse ve mě vybudovala jakássi rezisstence proti tomuhle pocitu, možná to bylo věděním, možná že ne. Mě nepřipadá náš ssvět tak hrůzný, protože nepřemýšlím nad jeho důssledky (což je možná chyba).

Dobře, jak sse učí draci z poznatků osstatních draků?
argonantus18.3.2003 (14:13)
Darkelf:
Příšerně těžké otázky. Beru si k ruce Nigreona... ono je totiž vůbec máloco lidského zajímá. Zejména skoro nic technického (a to je 90% lidské mysli). Pro nás je skoro nepředstavitelné, že bychom se nezajímali o oblečení, bydlení, dopravu a jídlo.... když škrtneš tyhle čtyři věci, většina lidských civilizací se odmlčí...
Zbývají asi vztahy. Hierarchie. Moc. Prostor. Čas. Hvězdy. Dobré i zlé věci, a zejména dost neuchopitelné...
darkelf18.3.2003 (14:16)
Argonantus: Když odškrkneš jídlo (zdroj energie) mysslím, že odškrkáš něco víc, než jenom cicilizace.......žeby celý vessmír! Ale na co jssi reagoval?!
argonantus18.3.2003 (14:21)
Darkelf:
zkoušel jsem i představit, jak se draci učí od jiných draků... a o čem to vlastně je...
darkelf18.3.2003 (14:26)
Argonantus: sstejně jssme zasse uhnuli. No mají Draci píssmo, nebo něco tomupodobné, aby sse ti mladí mohli učit od jiných v jejich nepřítomnossti. Nebo tohle obsstarává dračí magie?!
argonantus18.3.2003 (14:30)
darkelf:
Dračí písmo v mém světě vzniká magií... píše se na takové veliké kamenné stély; když to dokážeš přečíst, dozvíš se fakt zajímavé věci...
darkelf18.3.2003 (14:32)
Argonantus:
Ano, to jssem chtěl vědět, takže draci zapissují ssvoje zkušenossti na co? a pomocí magie! Rád bych někd narazil na jesskyni takového draka. Zatím z mých zkušenosstí bývají pouze obloženy kosstmi pošetilců.
argonantus18.3.2003 (14:34)
Darkelf:
adresu nejbližší jeskyně znáš. Můj svět je skutečný.

Jinak - co jsi říkal tomu kanovníkovi Vyšehradskému? Nemyslíš, že to trochu otřese fandologickou sebejistotou?
darkelf18.3.2003 (14:35)
Argonantus: co je to Fandologie? Nikdy mě to nedošlo!
argonantus18.3.2003 (14:40)
Fandologie je slovo pro dost běžný světonázor, který na tomto fóru zdatně reprezentuje Fanda. Skvostná ukázka je například na konci 28.2. ve 12.12.
darkelf18.3.2003 (14:43)
Tudíš, to otřássěá jeho výrokem o víře! Teď ale nasstává otázka jesstli kanovníkovi Vyšehradskému věřit či nevěřit! A zasse jssem v tom nekonečném kruhu víry, že!
argonantus18.3.2003 (14:48)
Darkelf:
Nevidím sebemenší důvod mu nevěřit... z jeho vyprávění mu neplynul žádný prospěch; a také netvrdil, že viděl přímo draka - tvrdí jen, že víc lidí toho dne vidělo něco, co vypadalo nejspíš jako drak...

Wothan: Sleduješ nás? Dá se to prohlásit za tornádo? Nebo to odložíme jako typické UFO?
darkelf18.3.2003 (14:50)
Argonantus: věrme mu tedy, protože sse nám to určitě líbí. Kdyssí tu určitě byli draci!

(ozvu sse za hoďku, mizím)

Lady sse nějak odmlčela?!
S.U.P.18.3.2003 (15:09)
Nevím kde berete takové informace.....strasne vas obdivuji jak se do rozvykladat o takovem tematu jako jsou draci.....

Já si draka představuji nějak podobně jak byl vyobrazen v jedne hře (no přiznavam se že jsem s ní strávil hoooooooooooooooodně času) a to v HoMaM II-IV. Většinou jako černé stvoření chrlicí smrtonosný oheň. No a pak jsem si jednou koupil pevnost začalo to asi 4. číslem. Už ale nevím ve kterém jsem četl nějakou povídku o dracích.... a tam jsem pochopil , že drak nemusí být jen zlý, ale zaleží i na tom jak se s ním jedná.

Ty bytosti co se báli draků je považovali za nebezpečné a zlé, ale našli se i tací co si s ními dovedli vyměnit i pár slov a dokonce se dokázali s nimi přátelit. No to jsem možná nějak zmotal ale nemůžu zato.... dnes jsem toho měl už dost. A to nepiju..... Stačí jen hodně dlouho civět na tu bednu co teď civis ty a pak je to všechno takové nějaké pomotané....:o)

Nevím jak na vás ale na mě působí slovo Drak vclku hezky. Zato Great Wyrm se mi moc nezamlouvá připadá mi nějak tak tvrdé označení něčeho jako je drak. Takže mam zato že Great Wyrm nemá s draky moc společného. Snad jen to že umí lítat a chrlit oheň asi taky neumí. Něco mi říká že by mohl produkovat spíš nějakou formu kyseliny.

Takže Great Wyrm by mohlo být něco jako Velký létající červ nebo něco podobného velkým létajícím dinosaurům. Rozhodně nemá stejnou charakteristickou kůži jako draci. Draci mají přeci šupiny ale né jako ryby ty je nemají tak pancéřované.

No to jsem toho napsal.

Jo, kde se dá sehnat něco o těch Drow. Dík darkelfe.....

Dík za odpověď S.U.P.
S.U.P.18.3.2003 (15:26)
Nevím jak vy ale ja neslyšel nikdý o více dracích na jednom místě... Takže jak se mohli jeden od druheho učit ?

Nedokažu si představit jak by chodili třeba do nějaké jeskyně kde by se dokázali naučit něco smi jen tak civěním na zeď s nápisy nebo jen s kresbami.....

Nevím a le připada mi to asi tak že už museli aspon něco znát tj. norodit se už s tím že uměli mluvit..... uměli vůbec mluvit a jakou řečí tedy mluvili?

Zase mě napadá spoustu otázek jak co a proč.... než ale dočtu to fórum tak už zase nevím co jsem chtěl....

Ach jo..asi si to budu psát...někam bokem..
argonantus18.3.2003 (15:50)
S.U.P.:
Vítám dalšího drakologa. Uznávám, že naše fórum je už hrozně nacpané; já to technicky řeším tak, že si příspěvek, který mne zaujme, celý "nasaju" do clipboardu, vypustím ho do svého nového, pak na něj odpovídám a to původní mažu. To přesně provedu s tebou. Takže:

- informace bereme různě; není obré se omezit jen na fantasy a hry. Pokud to projdeš opravdu důkladně, najdeš tu velkolepé odkazy na ryze dračí stránky.

- HoMaM samozřejmě znám, draci černí jsou tam prakticky nejlepší potvory vůbec (snad s titány a archanděly). Pro černé draky mám obzvláštní slabost.

- jak už se řeklo, drak má příšerně starou tradici i jako slovo; vlastně není u nás na Západě kloudná civilizace, která by draky neznala. Kdy a jak vznikl Great Wyrm, to se zeptej Darkelfa.

- chrlení ohně, kyseliny, jedu a všeho možného - začali jsme s tím někdy 3.3., a najdeš tam věci, nad kteýmiti bude přecházet zrak (mně teda přecházel)
Fanda18.3.2003 (15:56)
Nejprve začneme tím písmem - otázkou je, zda-li by tak dlouhověké národy s tak dobrou pamětí, jako jsou draci, nebo i elfové, potřebovaly písmo na záznam toho, co se stalo nebo udělalo - nemluvím teď o představách kohokoli - berte to jen jako otázku hozenou v plén.

Mno a jakožto zakladatel Fandologie ^__^, bych se měl vyjádřit ke kanovníku Vyšehradskému - mojí prababičku prý topil vodník - ona ho viděla a jelikož se vodník vyskytuje v lidové slovesnosti od dávných dob, dalo by se předpokládat, že vodníci jsou, nebo alespoň byli. Otázka je, zda-li vyprávění mé prababičky o tom, že viděla vodníka (založené na její víře v jeho existenci), dokazuje existenci vodníka.
Obávám se, že ani kanovník Vyšehradský s Fandologií příliš nezacloumá, protože, jak vám potvrdí každý etnograf, lidi zkrátka kecají a nedá se jim věřit - co my víme, třeba chtěl být zajímavý, nebo mu to pověděl někdo, kdo to slyšel od někoho jiného. Ostatně tuším, že jiný kronikář - Dalimil, kecal, až se mu od pera prášilo. No a kam vlastně to stvoření letělo? Je záznam ještě v nějaké jiné kronice z Polska, nebo Němec? Třeba to nakonec byla Enterprise řízená Kirkem ^__^
Já si totiž myslím, že stejně jako je zavádějící představa Boha (nebo jak si to nazveme) jako stařečka na obláčku, je stejně zavádějící i představa draka jako okřídlené ještěrky, co plive oheň, nebo vodníka, jako zeleného mužíčka na vrbě.

A doufám, že si i díky mým narážkám lépe promyslíte existenci draků a všemožné důkazy o ní - až najdete něco neprůstřelného, pak mi nezbyde než existenci draků jakožto těch ještěrek uznat.
argonantus18.3.2003 (16:05)
Fanda nesnesitelný:
dík za nemilosrdně materialistický přístup. Docela to oživuje fórum.

kanovník Vyšehradský: netvrdím samozřejmě, a netvrdil to ani on (všimni si pozorně), že viděl draka, neboť:
1) viděli to "jiní" lidé, a asi na různých místech
2) nebyl to drak, nýbrž "něco jako drak", a kromě toho, hned vzápětí, "ještě něco jiného"

nevyvozoval jsem z toho existenci draků, ale spíše pozouhodný stav ideje draka v té době - neznámý jev je popisován odkazem na draka jako na věc zřejmě zcela jasnou a známou (opakuji, mluvím o prakticky negramotném roce 1130 v Čechách, které sestávají převážně z pustého lesa).

Za velmi něšťastné ovšem považuji nakládání se zprávou tím způsobem, že pokud se mi něco nehodí do krámu, odpálkuji to mezi výmysly, sny a podobně. Teméř mi to připomíná barona Cuviera a jeho boj proti člověku neandrtálskému.
Wothan18.3.2003 (16:49)
Argonaut:
Jako český románský patriot bych si dovolil s tou pustinou trochu zapolemizovat...no spíš z hecu, jinak plošně vzato to tak tady počátkem 12.st. asi vypadalo.

Fanda:
Kanovník Vyšehradský toho naštěstí napsal víc a máme tak alespoň představu jakým stylem psal a co popisoval. Jeho styl psaní je od Dalimilovy obraznosti přece jen odlišný - a pokud bys chtěl skutečného vypravěče doporučuji Hájka a jeho kroniku :-) Soudím že je to podobně jako Kosmas důvěryhodný pramen. Ale jak psal Argonaut - celkem nezaujatě zapsal to co se mezi lidmi vyprávělo, prostě pro to že mu to pro daný rok přišlo zajímavé (s ohledem na váhu přikládanou tehdy všemožným a zvláště pak nebeským znamením to není nic zvláštního). Kdokoli by psal pro to aby byl zajímavým, napsal by to určitě jinak - mohl se prohlásit za svědka toho jevu, mohl jej podat podstatně barvitěji...on ale místo toho velmi stručně reprodukoval to co se mezi lidmi šířilo. Nenacházím tu nic co bych mu vytkl. Jinak tohle není důkaz existence draka - chápal jsem to jako argument pro to že tu již tehdy byla mezi lidmi nějaká představa o tom jak by asi měl takový drak vypadat, když tomu jevu přisoudili tuhle podstatu. Aby tvoje babička mohla tvrdit že ji stáhl vodník musela mít nějakou představu jak takový vodník asi vypadá a proč to dělá ne? A je v tuhle chvíli celkem jedno že tam žádný vodník nebyl. beru ten argument jako odkaz k existenci vžitého archetypu, nic víc.
Wothan18.3.2003 (16:50)
Tedy Kanovník je podobně jako Kosmas či Mnich Sázavský v mezích možností důvěryhodný pramen...ne ten Hájek :-))
Argonantus18.3.2003 (17:14)
Wothan:
jo, tak přesně to vidím. Podotýkám jen, že kanovník Vyšehradský se rád a mnohem častěji díval ma nebe, než většina jeho kolegů (mnich Sázavský, Kosmas atd.)
Jinak - co by řekl Fanda zcela materialistickému vysvětlení; třeba takový meteor? Letí, chrlí ohnivé efekty, mohou ho zahlédnout z víc zemí...

Jinak jsem zatím přes sebepečlivější hledání v Kosmovi i v Pokračování nenašel lepší tornádo, než toho mnicha Sázavského - "bylo viděti létati hada", k r. 1142...
Wothan19.3.2003 (9:00)
Argonaut: hledám taky, ale zatím marně - co si ale pamatuji tak tam není zmínka o dracích ale o větrném víru který tuším že smetl z mostu jezdce...(pokud si to nepletu s jinou událostí)...hledám dál.
argonantus19.3.2003 (9:57)
Wothan (a všichni přiznivci a odpůrci středověku):

Tak, přátelé, jdu do toho. Donutili jste mne projít celého Kosmu i Pokračování, abych shledal následující:

1) Kosmas byl papírový intelektuál, který se na nebe a přírodu díval minimálně; spoustu historek konstruoval čistě literárně; nicméně byl ve skutečnosti milovník příběhů, a to i pěkně epických a hrdinských. Pro naše účely je dost nanic.

2) Mnich Sázavský je odpovědný za většinu povětrnostních vsuvek v Kosmovi. Kromě toho hada 1142 jich má ještě několik; zvlášť mne zaujalo, že v kritickém roce 1130 praví, že
"dne 25. dubna zjevilo se obrovské znamení a bylo slyšet hrozné hřmění." Pravda, o půl roku jiné datum, než kolega z Vyšehradu - ale protože to oba psali zřejmě ex post, po mnoha letech, není náhodou možné, že mluví oba v roce 1130 o téže události?

3) Kanovník Vyšehradský - toť ovšem skutečná perla. Za pouhých 16 let jeho kroniky má nějaké zajímavé UFO skoro každý rok, a jeho pozorování jsou okouzlující svojí věcnou přesností.
Najdeme tu bouře, sesuv půdy, několik nových hvězd (? komety či novy - te´d nevím), několik netypických zatmění měsíce, meteor, sluneční skvrny a také pár nejasných UFO, jako ten drak roku 1130.
Zájmu o nebe v této kronice si všimlo už i pár profíků, takže někde existuje pojednání "Astronomické zprávy v kronice vyšehradského kanovníka", Link, 1961; a také "O astronomii a kronice a jak to spolu souvisí" od Linka a Ivanova.

4) kromě roku 1130 - který pro přehlednost cituji znova:
"téhož roku dne 8. října jednu chvíli, totiž při západu slunce, bylo viděti jakousi obludu, draku podobnou, jak letí přes celé Čechy i přes mnoho jiných míst. Potom však mnozí viděli jiné znamení, velmi jasné, v jitřní hodinu."

je zajímavý také rok 1135 s tím meteorem:
" V Durynsku spadl z oblak na jednu rovinu kámenm divné velikosti, jako veliký dům, zvuk od něho slyšeli v okolí bydlící lidé už po tři dny napřed; když dopadl, polovice se ho zaryla do země a tři dny ležel horký, jako ocel z ohně vytažená."
To jen na vyvrácení mého vlastního nápadu vysvětlení r. 1130, a také na ukázku té přesnosti a serióznosti (jsem si jist, že nějaký Fandolog okolo r. 1800 by to jistě také prohlásil za výplod choré mysli...)

a konečně - OBZVLÁŠTĚ zajímavý je rok 1138:
"Dne 26. února po západu slunce bylo spatřeno po celých čechách jakési znamení v podobě draka, jak letí na západ, a náhle zmizevši, zanechalo za sebou načervenalá znamení.
Před letnicemi, dne 11. května, se zjevila na severní straně na nebi červená znamení ve tvaru sloupů, na dvě části rozdělená, a zdálo se, jako by se v boji utkávala, brzy zase vzdalovala."

takže - máme tu už druhé drakoidní UFO (a tentokrát se jedná zjevně o cosi meteorologického či astronomického, vzhledem k těm červeným znamením), a vzápětí to slíbené tornádo jako lusk.
Nenapadá mne lepší důkaz, že tornádo nebývalo zaměňováno s drakem; alespoň u zkušeného machra, jímž je nepochybně náš výtečný kanovník.


5) P.S. S tím Dalimilem jste mne fakt nasrali... neexistuje průkazné místo, kde by si Dalimil něco vymyslel; pouze pletl doby a získané prameny - ale to je téměř na samostatné dlouhatánské fórum, ve kterém bych byl asi brzy sám.
argonantus19.3.2003 (10:17)
a na lehčí notu - během naší debaty se objevily na hlavní stránce dva články od "darth bane" Vejnara, oba o dracích... ten předtím, od někoho jiného, se mi líbil víc...
Wothan19.3.2003 (10:36)
Argonaut: no - zkus srovnat Kosmu s Dalimilem. To že si plete data je jedna věc, ale já jsme psal že Dalimil oplýval především mnohem větší obrazností než jeho předchůdci, ne že byl přímo fabulátor (což bych třeba u Hájka s klidným svědomím řekl). Zajímavé je to především tam kde nepopisují skutečné hist. události ale mýty (Vyprávění starců) - srovnej třeba Dívčí válku Kosmovu s Dalimilovou? Dalimil bezpochyby neměl víc podkladů a pramenů než Kosma, bezpochyby Kosmovu kroniku znal, ale jeho pohled na stejnou pověst je nepoměrně barvitější a venkoncem vyznívá i úplně jinak. Tolik co vím o tzv. Dalimilovi.
argonantus19.3.2003 (10:40)
Wothan:
Dalimil - dejme tomu, takhle bych to bral. Ale jak říkám - to je na jiné fórum; nezasviňujme si draky.
Spíš mne zajímá, co říkáš mému výlovu z Pokračovatelů?
darkelf19.3.2003 (13:26)
S.U.P. :

Draci ( v tom máš pravdu jssou v podsstatě ssamotářští), ssnad díky jejich neutralitě, ssnad je to o tom poznat co nejvíce nových věcí (každý ví, že když je ssám, má na ssvět poněkud jiný pohled, než když je ve dvou). A protojssem (ssnad i z nouze) nadhodil otázku o dračí kultuře, píssmu nebo něco jiného.

No dračí píssmo vytissknuté do sskal pomoci magie není tak zasse hrozné. Pokud vezmeme draka jako něco, co děla dozorce nad využitím přírody, mohli by drací čísst z pouhých nessrovnalosstí kamenného povrchu. Podle mágů vím, že pokud chceš sspojit ssvoji myssl ss elementární plání země (a využít jejich moci, známou jako zemní maggi) potřebuješ ovládat jejich jazyk. To by znamenalo, že draci zapissují ssvoje životní zkušenossti díky magii, přírodě nejbližší.

Draci v HOMAM bývají čassto ssmrtonossnou zbraní, a pokud jssi viděl draky azurové, tak možná i více než ssmrtonossnou..

Draci nejssou v podsstatě nakloněni zlu, jenom dělají to, co cítí, že je ssprávné, a když tomu přičteš jejich neobvyklou moudrost, dá sse říct, že chyby dělají hodně málo (nebo jednoou za život)

Great wyrm: je označení v bestiářích ADnD: je to forma draka, který má více než sstrášně moc let (z hlavy ti to nepovím). Já vím, že označovat draky podle toho jak jssou sstaří, je hloupý, ale když to vidím v česských překladech jako Velký červ?!

O Drow ssem ti něco málo posslal na email, pokud sse nebudeš zlobit!
darkelf19.3.2003 (13:49)
Fanda: Elfové mají ssvé píssmo, ale důležité věci (jako to kdyssi dělali druidové) se pro možné zneužití předává sslovy!
darkelf19.3.2003 (13:56)
Argonatus:
V lidsské hisstorii sse hrabat nebudu (ssnad je to mým pohrdáním, ssnad tím, že bych nic na to neřekl)
Je logický, že sse ti článek nelíbil, zessměšňuje totiž draky, ale mě, Dow, naopak zaujal a doela jssem sse u něj pobavil!
argonantus19.3.2003 (14:14)
Darkelf:
ne snad přímo nelíbil... to by bylo zbytečně kruté... jenom mi přišel příliš po povrchu věci klouzající... mám rád věci zneklidňující, co pronikají pod kůži...

Nemohu po každém chtít, aby mne ohromil Wothanovským přívalem úžasně přesných faktů... ale nějak mi unikl autorův POSTOj k drakům, což už jsem vysvětloval na Bohu... nevadí mi posměšný postoj (draci to klidně vydrží), spíš mi vadí prázdnota
darkelf19.3.2003 (14:16)
Argonantus: ber to jako fejeton k naši disskuzi!
Fanda19.3.2003 (14:19)
No, co já se na sebe ještě nedozvím ^__^

Argonantus+Wothan: Já neříkám, že si toho "draka" kanovník Vyšehradský vymyslel a tou příhodou s mojí prababičkou jsem chtěl poukázat právě na to, že ze znalosti, jak by takový drak měl vypadat, může dojít k pojmenování nějakého jevu jako draka, což jste vy dva ostatně dostatečně vyjádřili níže. A hlavně jsem chtěl oponovat až fantickému Darkelfovu přijímání všeho, kde se nějaký drak vyskytuje. A přiznejme si jeden smutný fakt, že lež, ať chtěná, nebo nechtěná, je stále a vždy jednou z možností a tak nějak je dobré s ní počítat - ovšem ne fanaticky vyznávat - pak je to také na nic. Spíše jsem chtěl poukázat na to, že podobné zmínky je dobré pořádně zanalyzovat, než se začnou vynášet horečnaté verdikty nad existencí draků.

Darkelf: A kde si sebral, že elfové písmo měli - ano, Elfové v Tolkienovi psali, psali i elfové v Sapkowském, jenže jsme tu zase na tom samém co s těmi draky a řekně me si, že ještě hůře, protože představa elfa se rozšířila snad až díky Tolkienovi - pokud tedy bys pod tímto vlivem neoznačil slovanské víly šmahem za elfy. Pro mě, za mě, věř si v existenci elfů a draků, když to z tebe bude dělat řádného člověka, ale nevnucuj svou víru ostatním za pravdu.
argonantus19.3.2003 (14:20)
darkelf:
beru.

Wothan: Co ty na zhroucení teorie tornáda? (dnes ráno)

Fanda: tebe se radši neptám - vlastně nevidím důvod, proč by se tvůj názor měl vlivem dalších podobných zpráv jakkoli vyvíjet

S.U.P. - azuroví draci mi už moc k srdci nepřirosli... čeho je moc, toho je příliš...
darkelf19.3.2003 (14:26)
Fanda:
Dík, že sse o mě bojíš (dokážu ještě ale žít i v téhle rovině)
A elfové, to je tvůj názor, ale někdy v životě poznáš, že všechni bájní tvorové mají určitou předlohu v lidech a jejich chování, takže kolem ssebe najdeš mnoho elfů a mnoho jiných sstvoření......jinak jssme na fantassy sserveru, proč bych nemohl rozvíjet nessmysslné teorie o těch, co jssou mé duši nejbližší:)
darkelf19.3.2003 (14:27)
Argonantus: Azurový draky jssem nadhodil já!
Wothan19.3.2003 (14:36)
Argonaut: nějak jsem nepostřehl že by se teorie tornáda nějak hroutila. Měla by?
argonantus19.3.2003 (14:43)
Fanda lehce z míry vyvedený: (bezva, je to osobní!)

Nesprávná interpretace faktu ještě zdaleka není lež. Realita má mnohem jemnější odstíny.

Jinak připomínám, že v téhle debatě neustále přeskakuji z různých realit; zpráva kanovníka Vyšehradského je přece jen něco dost jiného, než moje - čistě z mého světa a mnou vytvořená - informace o dračím písmu, tvořeném magií; moc pevně si za tím nestojím
(geniální citát jednoho mého známého: "Zde stojím, ale mohu i jinak!")

Nepříjemné či pobuřující není možno ztotožnit s "horečnatým" - ten, kdo říká pobuřující věci, bývá naopak daleko častěji ledově klidný (viz Divous a double ss, i když jsou možné i jiné verze výkladu)

Elfy odkazuji k jinému fóru - jinak v zásadě souhlasím, že nelze bezduše tolkienizovat

A to hlavní - víra v Drow nebo v draky - či naopak nevíra - nečiní člověka dobrým, či špatným (viz sáhodlouhá debata o Dobru na Bohu)
argonantus19.3.2003 (14:44)
Wothan:
obávám se, že je přinejmenším ohrožena - dnes, v 9.57 jsem ve svém sáhodlouhém výlovu objevil to tornádo.
Wothan19.3.2003 (14:48)
Buď jsem slepý nebo jsi to tornádo nenašel. Byla to naprosto zřetelná zmínka o vzdušném víru. V té zmínce není ani přirovnání ani jiná personifikace tohoto zjevně přírodního jevu. Když jsem o tom mluvil tak jen jako o důkazu existence tohoto jevu i v Čechách raného středověku - jistě se tu něco podobného mohlo objevit i dříve.
argonantus19.3.2003 (14:54)
Wothan:

s nehynoucí láskou k tobě lapám do clipboardu a kopíruji:
rok 1138:
"Dne 26. února po západu slunce bylo spatřeno po celých čechách jakési znamení v podobě draka, jak letí na západ, a náhle zmizevši, zanechalo za sebou načervenalá znamení.

Před letnicemi, dne 11. května, se zjevila na severní straně na nebi červená znamení ve tvaru sloupů, na dvě části rozdělená, a zdálo se, jako by se v boji utkávala, brzy zase vzdalovala."

Dvě zprávy, bezprostředně za sebou, tentýž rok, ale jiné datum. ta druhá je podle mne tornádo jako vrata (červená znamení ve tvaru sloupů).

A k tomu můj ranní komentář:
Nenapadá mne lepší důkaz, že tornádo nebývalo zaměňováno s drakem; alespoň u zkušeného machra, jímž je nepochybně náš výtečný kanovník.
darkelf19.3.2003 (14:57)
Ale drak je sstarší než Kanovník, to ssnad myssle othan, né?!
darkelf19.3.2003 (15:01)
....myslel Wothan...
argonantus19.3.2003 (15:06)
Darkelf:
teď jsem zbloudil ve všech realitách...
idea draka je zaručeně mnohem starší; o to se asi nikdo nepřeme (jak jinak by se mohli dostat draci na Keltské mince?)

Pokud jde o draka, kterého viděl kanovník, pak jsou jejich stáří různé odpovědi:

1) v Plánu 1 šlo o UFO, a tudíž byl starší kanovník (neb drak zanikl)
2) V Plánu 3 - mé realitě - to byl možná Nigreon, a pak byl nepohybně starší, než kanovník
3) nebo to byl jiný drak v Plánu 2, neprokázaný a nevyvrácený, a o jeho stáří nemám žádných zpráv.
4) A to ještě vynechávám, že kanovník viděl draky dva.

Je to ještě srozumitelné?
darkelf19.3.2003 (15:08)
Argonantus: ale to nevyvrací, že kdyssi dávno někdo mohl považovat tornádo za draka. Ale je jissté, že tahle předsstava jako draka sse nedožila sstředověku!
argonantus19.3.2003 (15:12)
darkelf:

Jistěže máš pravdu. Důkaz to není. Já také považuji kanovníka za nadprůměrně schopného pozorovatele (ve srovnání s konkurencí) - je docela možné, že mnich sázavský si tornáda a draky pletl... co jinak má znamenat to praštěné "bylo viděti létati hada?"
darkelf19.3.2003 (15:15)
Takže tornádo má více sspojitosstí ss létajícím hadem, než ss drakem
S.U.P.19.3.2003 (15:17)
Ti Azurový draci byli ti co měli nějakou tu magii v inventaři je to tak?
darkelf19.3.2003 (15:18)
S.U.P: Ne to byli pohádkoví draci. Azuroví byli ti modří a velmi ssilní, co způssobovali sstrach!
S.U.P.19.3.2003 (16:58)
No ja jsem si to pozdějc taky uvědomil ale pozdě byls rychleji u netu.... darkelfe :-)
Wothan19.3.2003 (17:01)
Argonaut: no nevím - ty sloupy bych za tornádo asi nevydával, to prostě není ta zpráva o které jsem mluvil já. To nijak nepodporuje mou tezi - všimni si že teď se spíš v zájmu objektivity popírám :-) Ale co jsem tvrdil já není to že tornádo bylo v době Kanovníka Vyšehradského (nebo Kosmy, Mnicha sázavského a čert ví koho ještě v době historické) běžně považováno za létajícího hada. Ber to tak že abys z tornáda udělal mýtické zvíře musela by společnost být na mnohem nižší, primitivnějším stupni vývoje. Když zafabuluji - kdysi v dávnověku (bóže jak miliji tuhle terminologii) lidé mnohem jednoduššího ražení personifikovali vzdušný vír a dali mu tvar. Na tuhle kostru v průběhu věků navěsila lidská fantasie tvar a vznikl mýtus - létajícího hada, draka...to ale neznamená že se této personifikace musí apriori užívat navěky. V době Kanovníkově už možná neviděli v tornádu draka ani létajícího hada...zato ten archetyp už tu byl "odjaktěživa" (už zase...) zasetý, proto věděli kam mají v případě přirovnání sáhnou "podobný draku..." apod. Jasno?
Fanda19.3.2003 (19:27)
Já si říkal, že jsem si kapánek naběhnul.. -_-""" *červenám se*
A pokud to Darkelfe bereš takhle, tak nezbývá než souhlasit.
S Argonantem souhlasím a v podstatě jsem to i psal.
Jinak mě těší, že i jiní tady spekulují o věrohodnsti jednotlivýxh důkazů ^_^

No a když už je to ten fantasy server, co takováhle představa o dracích:
Jsou 2 typů - draci Země a draci Nebes. Draci Země jsou jsou ochránci planety a s nevolí sledují, jak ji lidé ničí. Draci Nebes jsou naproti tomu ochránci lidí, neb si uvědomují, co všechno krásného lidská kultura učinila a zároveň oni jsou strážci 7mi pečetí, jejichž zničení může vést ke zkáze lidského rodu. Draků je 7 z každého rodu a je to jakási prapůvodní síla, která ale sídlí v tělech určitých lidí a propůjčuje jim nadpřirozenou moc.
Tolik první část poudačky.
argonantus20.3.2003 (9:04)
Fanda:
Poudej dál, babi. Možná to bude zajímavé; budeš možná sám překvapen, co zajímavého haraburdí nosíš v hlavě.

Wothan:
No jo. To spolu zase spíš souhlasíme. Mohu snad jen jemně upřesňovat - neobvyklost tématu a nevzdělanost pozorovatele jsou v přímé úměře s mírou personifikace...
zatímco obyčejný "chlap" někde na poli by dávno blábolil o ďáblech, nebo kdovíčem, náš docela přírodovědně zběhlý kanovník užívá slova, která podle něj nejlépe sednou, a popisuje přesně, co vidí - "dva sloupy, které jakoby zápasí." Kdybych nesměl užít slova tornádo" nebo "větrná smršť" (protože o fyzikální podstatě jevu nevím na dálku vůbec nic), možná, že bych nic lepšího nevymyslel...

mimochodem - překvapilo by tě hodně, kdyby ten kanovník opravdu viděl nad Vyšehradem draka? Můj svět by se nijak nezhroutil.... a mimochodem, odbočka - právě tak vznikají zárodky uměleckých nápadů. Chce se to jen do té situace dokonale vžít (a to jako milovník středověku jistě děláš často). Kanovník sedí někde u kapitulního domu venku, popíjí nějaký starožitný chlast )já vím, že by neměl, ale určitě to dělal), krásný den, nad Vltavou létá ptactvo nebeské, dole zdálky je slyšet nejasné kecání hádajících se dřevařů z Podskalí, a najednou - drak...
kanovník není překvapen; sleduje to se zájmem vědce...ale nás napade - odkud a kam ten drak letí, co má v úmyslu, co z toho všeho vzejde...
darkelf20.3.2003 (9:39)
K drakům: Taky považuji čásst draků jako ochránce a sstrážce přírody, ale jak jssi došel k těm ochraňovatelům lidí. Proč by je chránili?
Wothan20.3.2003 (11:14)
Argonaut: proč by nemohl pít? Nejspíš by pil víno, ale i medovinu...církev v Čechách 12.st. je otázka sama pro sebe a k nějakému ideálu má velmi daleko. To že by byl dobrý kronikář zpitý namol (což netvrdím) by byl jen zanedbatelný prohřešek vedle běžné praxe na kterou tu narazil chudáci legáti Guido nebo i Petr z Capuy :-)) Nepochybně znáš personální zemětřesení, které tu oba dva v rámci církve provedli poté co se vzpamatovali z prvního šoku...kupříkladu vyšehradské kapituly byl ženatý, ale navíc laik a pro změnu děkan téže kapitoly který sice nebyl laik ale měl pro změnu tři manželky...děkan a kanovník Olomoucké kapituly dostali padáka pro nemravnost apod. Taky nechybělo moc a Petra ubili rozzuření kněží za to že si dovolil žádat po nich při svěcení slib celibátu.......jó od dob kdy tu první misionáři zhnuseně prohlásili že tu bují kult nevázaného sexu a medoviny se toho ani v této osvícené době mnoho nezměnilo :-))
Wothan20.3.2003 (11:16)
Probošt vyšehradské kapituly ...vypadl mi z textu. Omlouvám se tohle není od racích a je to off topic, to je jen tak na okraj jako příspěvek k boření mýtů a zakořeněných představ či ideálů :-))
argonantus20.3.2003 (11:40)
Wothan:
ne, já s tím opět naprosto souhlasím; a jako tvora bezbožného mi lajdácký přístup našich předků ve 12. století (o kterém se údajně vyprávěly anekoty v daleké Francii - prý tehdy český kněz= náš dnešní policajt) imponuje a naplňuje zlomyslným endorfinem, naopak takoví týpci, jako Bernard z Clairvaux, Jindřich Zdík, nebo i můj dávný český jmenovec, mi šli vždycky na nervy... ale to je spíš k tématu Bůh.

Chtěl jsem jenom v té své umělecké ilustraci poznamenat, že kanovník vyšehrads
ý se mi skrz ty řádky jeví být jako právě typický český pohodář, co místo modlení růžence radši pozoruje draky a jiné výstřednosti...
S.U.P.20.3.2003 (12:44)
kdyby existovalo fórum kde by se dalo jen tak sedět a pozorovat draky.

No jo to by nebylo vůbec špatné.

Tak mě napadlo mohl by upír nějak vysát drakovi krev?

Podle mě maji draci velmi dobře pancéřované tělo :-)

To by mu muse lvlézt nějak do nitra ale...vezmuli na vědomí že by ho to mohlo pěkně popálit... další otázka jak vzniká vlastně oheň v drakově těle?
Wothan20.3.2003 (12:45)
Argonaut: vidíš? bez konfliktů není žádná plodná diskuse....že bychom se vrátili k drakům, sexu a medovině? :-)
argonantus20.3.2003 (12:56)
Wothan:
no, mohl bych dále rozvíjet téma konfliktním způsobem; například, že drak nad Vyšehradem byl ve skutečnosti pokémon charmander, prvé vývojové stádium (to koukáš, co se člověk taky někdy musí učit...!)- ale je mi to samotnému proti mysli.

Ale je ještě tisíc věcí, co chci o dracích vědět; některé jsem už nahodil, ale nikdo se mi na ně neozval; ale v některých věcech projevuji děsivou trpělivost (například - Merkurius, sv. Jiří, Darkelfem slíbený mrazící dech...) Kdysi jsem chtěl napsat o dracích knihu; pak jsem si řekl, kdo to asi tak bude číst; načež to někdo vydal (Montse Saint a Ciruelo - Draci, moc hezká kniha) - nicméně nakonec nelituji, protože jen na tomhle fóru jsem se dozvěděl spoustu nových věcí...

S.U.P. - to tě k tomu přivedla Lady Candar jinde? No, asi by měla upírka problém to všechno vypít... ale tím jsi mi připomněl úžasnou myšlenku nemrtvých draků. Myslel jsem, že je to můj vlastní nápad (použil jsem to v jednom RPG s velkým úspěchem, kdy padouši oživili mrtvolu dříve zabitého draka), nicméně pak jsem to našel u toho Ciruela, kde je kostlivý drak dokonce krásně vymalován... a ještě potom jsem je našel na HoMaM, kde je to normální věc. Takže zase nejsem původní. Nicméně, zajímalo by mne, jestli jsi na tenhle šílený nápad narazil v "dávnověku", Wothane
argonantus20.3.2003 (12:58)
S.U.P. -
promiń - ten oheň - i tohle naši drakovědci na tomhle fóru úžasně řešili, je to někde v polovině. Máš-li jen obyčejné připojení via Telecom, doporučuji celé tohle monstrum nasát, odpojit se, uložit a prostudovat.
S.U.P.20.3.2003 (13:02)
Tak ten oheň jsem přehlíd ups..


Jinak čím by se takový kostěný drak mohl živit.... jak by to travil....viz HoMaM to je něco jak funguje kostlivec může vůbec něco takoveho realně existovat?
Wothan20.3.2003 (13:03)
Argonaut: kostěný drak? Mám kostěný hřeben, šídlo, jehlu...ale draka ještě ne. Ale vážně - něco takového by skoro automaticky odkazovalo k fosíliím i když pohybující se fosílie jinak než při sesuvu svahu naleziště nebo zemětřesení v muzeu asi běžně neuvidíš. A k dračím revenantům - nikdy jsem nic takového v mythologii neslyšel. Ono vůbec spousta zhůvěřilostí vzniká z per a mozků autorů a hráčů her a to jsou věci které mne míjí a neoslovují. Spousta potvor a bastardů vám tu vzniká jen z technické potřeby skloubit nějaké vlastnosti a účel zjevně světí prostředky...ale jak říkám, pokud vane vítr odtud (stejně jako ti pokémoni) tak tomu já vůbec nehovím a nerozumím.
S.U.P.20.3.2003 (13:04)
připojení pevná nemocniční linka...
argonantus20.3.2003 (13:10)
Wothan:
jistě - je to jen fantastická maximalizace (jako ten teoretický radioaktivní drak, kterého zavrhl i velmi tolerantní Darkelf).
Moje původní podezření bylo, že právě tak nějak vznikl dávno i mýtus chrlení ohně - čím by byl drak ještě úžasnější, než největší zbraní hromadného ničení té doby... na způsob řeckého ohně, že? Apropos, existuje nějaký ohněstrůjný drak opřed vynálezem řeckého ohně...? Nikdy jsem si tuhle otázku nepoložil...

nicméně - jako umělec nesouhlasím. Nemrtví mají svoji nepochybnou magickou sílu a tradici. Nemám žádný důvod v ně věřit reálně (narozdíl od draků), ale myšlenka je to vpodstatě velkolepá, protože číémsi zneklidňující... je tu také taková jistá míra pravděpodobnosti... setkal ses někdy s opravdovou mrtvolou?

Nemrtvý drak pochopitelně nejí. Je nemrtvý; spojuje poezii nemrtvého i draka; je příšerně cizí.
argonantus20.3.2003 (13:44)
Ještě, než se pro dnešek odmlčím, dlužno poznamenat, že jme prošvihli malé jubileum - třístý příspěvek (a tím dočasné druhé místo za elfy - leč nezoufejte, TrPašíci - vše se může změnit).
Tušil jsme, že Draci jsou silné téma - ale výsledek mne samotného překvapuje. Děkuji všem drakovědcům.

Redakce - je tu myšlenek na celé další dračí číslo; jen to vzít za správný konec.
Wothan20.3.2003 (13:53)
ARgonaut: setkal...bohužel. Není na tom nic tajemného, zvláštního, prostě nic - buď je to velmi smutné nebo lhostejné. Kdysi jsme měli jako děti na zahradě boudu postavenou z rakve v které do ČR poslali nějakého horolezce - ze zinku byla střecha, z bedny (vnější obal do letadla) bouda...ironie. Co se nemrtvých týče...taky jsem četl Stockera :-) (a mimochodem nikdo podle mne dosud nedosáhl jeho kvalit). Ale nemrtví jsou samozřejmě zajímaví i v tradici - ať už Antické nebo středověké - u nás jsou notoricky známé pohřby revenantů, případně opakované zásahy na pohřbených apod. To nepochybně zajímavé je...ale zajímavé je to asi hlavně pro to že se to týká lidí. Jinak mýty jsou zajímavé právě pro to že neříkají nic jednoznačně, jen naznačují a hrozba je často pouze tušená....technokratismus RPG a moderního pojetí kde čeho včetně magie mne nudí a nezajímá, proto mám odpor i k podobným hybridním účelovým bastardům.
Fanda20.3.2003 (14:47)
Wothan: na druhou stranu mýtus není mrtvý a dále se vyvíjí ovlivňován těmi, jež mýtus šíří - co my víme, co se bude vymýšlet za 100 let a jaké představy budou zakořeněny v myslích snílků

Darkelf: Ha, ha, nechť začíná konflikt dvou představ! V tvé myssli jsou draci evidentně jakožto sstělessněná přírodní moc, která tresstá - zřejmě přetažená z evropských legend, jen došlo k převrácení rolí - drak je dobro a člověk zlo. Jenže vem si právě draky Východní - ti takhle nevypadali, nebo ne všihni.
Více v druhé části poudačky:

Draci obou stran budou spojeni pod vedení dvou sester - vědem, jež dokáží tvořit a nahlížet do snů. Jejich boj však bude nerozhodný, dokud nepřijde ten, jež nese boží jméno a vyzbrojen mocným mečem - na jakou stranu se přidá, tu posílí a ta pak vyhraje.
Zde poudačku končím. Přiznávám také, že není z mojí hlavy - jedná se o "mytologický" podtext mangy s názvem X od supiny CLAMP a ač se jedná o "moderní splácaninu", přece jen mne tato myšlenka zaujala a tvoří krásný příběh a rozhodně ne černobílý - a o krásné příběhy přece jde, nebo ne?
Wothan20.3.2003 (15:11)
Fanda: to je pravda, ale myslím a nechci se tu nikoho dotknout - že způsob jakým věřili naši předci mýtům a to co tu leckdo vypráví o své víře v cokoli bude diametrálně odlišné.
argonantus20.3.2003 (15:43)
Wothan:
když jsem tohle fórum zakládal, uvažoval jsem, zda se mám věnovat takovým problémům, jako dosah dračího dechu v sázích, typy blesků, sesílaných draky a podobně... pak jsem si řekl, že raději začnu tím, co mne opravdu zajímá; reálnost draka, reálnost mýtu vůbec, vnímání fantastična a tak...
v zásadě trpím podobným primitivismem, jako ty - je-li mýtus dostatečně uleželý (nejlépe z 12. století), působí na mne jaksi seriózněji (všimni si mého spontánního výkřiku na hermetismu)
sám se přesvědčuji, že věc asi není tak úplně jednoduchá; záleží nejen na stáří, ale také, JAK kvalitně je mýtus zbudován; Glaurung je zjevně umělý výtvor pana Tolkiena, ale to mu nebrání, aby to nebyl v jistém smyslu nejlepší drak všech dob a věků...

vnímání mýtu dříve a nyní - také závratné téma, protože nemáme důkazy; ale troufám si mírně nesouhlasit; i tehdy byli mezi lidmi propastné rozdíly, a to tak velké, že možná mažou rozdíly mezi věky; jinak by se na to díval Bernard z Clairvaux, jinak opat Suger a jinak kanovník Vyšehradský... zkrátka, i tehdy byli lidé s myslí otevřenou; lidé tolerantní; lidé, co věří naprosto všemu; lidé, co nevěří ničemu...
v zásadě ale myslím, že jádro pudla je ve středověkém POSTOJI, že věci zároveň jsou a zároveň znamenají - a to klidně víc věcí najednou. Dnes pro většinu lidí věci jenom jsou (objektivní realita), nebo jenom znamenají )písmo, umění). Středověké myšlení se ale začíná v době postomoderní zadními vrátky vracet... jinak řečeno, že jsme dnes otevřenější středověkému vidění světa, než doba před asi třiceti lety... je to ještě srozumitelné?
argonantus20.3.2003 (15:47)
Fanda:
opravuji názor, že jsem byl v minulém životě Fandou. Teprve dnes jsem pronikl k tvé vášni pro manga, což je svět, který je mi naprosto utajen; to je také důvod, proč se ti zdá (zřejmě právem), že přehlížím a podceňuji draky Východu. Samozřejmě o nich vím... a mají tradici možná větší, než ti naši; ale nemám k nim ten samozřejmý, blízký a přátelský vztah, jako k tomu kanovníkovi a Vyšehradu; Orient je pro mne tak trochu záhada.

Jenom dlužno poznamenat, že tvé představy a vášně jsou ve striktním rozporu s tebou hlásanou Fandologií; v takové dvojím světě může žít snad jen Japonec.
Wothan20.3.2003 (17:02)
Argonaut: ehmmm...Glaurung není osobní výtvor pana Tolkiena...a nebo je, to bych mu zase křivdil, ale specielně u tohohle literárního počinu bych se pozastavil - projdi si Tolkienovu verzi a projdi si mýtus o Sigurdu Fáfnirbanim. Je to jeden z nejznámějších mýtů starogermánské mythologie (podobně jako celá tahle povedená rodinka - Sigmund, Sigurd...Volsungové, Nibelungové). Tolkienova konstrukce je samozřejmě trochu jiná, zasazena do jiného rámce, ale najdeš tu dostatek až nápadně společných rysů, aby bylo možné mluvit o zjevné inspiraci.
Fanda20.3.2003 (18:29)
Argonantus: Přece sis nemyslel, že tu hned na sebe vyklopím, že jsem otaku, ale ty divné smailíky mohly napovědět. ~_^

Popravdě můj postoj je velmi šroubovaný - líbí se mi snít o dracích, elfech a všem tom okolo a proto nevěřím tomu, že kdy byli, protože A) poze uvěřit je až příliš snadné a B) kdyby skutečně byli, a my to věděli, tak o čem bych pak snil - zkuste snít o židli, na které sedíte - moc dobře to nejde.

A pokud jde o ten Východ - je to zkrátka jiný pohled na tu samou (nebo podobnou) věc, jako je třeba drak - a neříkám, který je lepší - pěkné jsou oba, protože z obou se dají zosnovat Přiběhy a ty evropské nejsou o nic horší, jen jiné.
Lady Candar20.3.2003 (19:06)
Ja se taky hlasim k hrdemu odkazu otaku. ^___^

Ehm... Fanda... ten Fanda? Z manga konfery?
Fanda20.3.2003 (19:58)
Candar, ty znáš jiného? ^_^
A abych ti to dokázal - tak díky za stříbrný autogram - však ty víš.
Wothan21.3.2003 (9:36)
Snít o židli jsme nezkoušel, snít o našich předcích, o kterých na rozdíl od draků a elfů máme plná muzea důkazů ale lze...navíc snít se dá i rukama. A vždycky zůstane spousta nezodpovězených otázek, jestli potřebuješ pro své snění nejistotu a nějaká ta bílá místa na mapě. Mně nevadí prožívat Tolkienovy mýty ani s vědomím že je to beletrie, co nedovedu pochopit jsou lidé, kteří se jen s vědomím "pouhé" beletrie nesmíří a krkolomě napříč všemi klouby lámou realitu do podoby ze které se snaží vydojit alespoň kapku naděje, že jejich oblíbené mýty a postavy by mohly stát na nějakém reálném základě. Přijde mi to hloupé...ale asi to souvisí s Argonautovou tezí o tom že věci které alespoň budí dojem reálnosti jsou prostě přitažlivější.
argonantus21.3.2003 (10:09)
Všichni drakovědci:
Wothanovo 17.02 jako reakce na mé včerejší 15.43 mne napřed vedlo k banálnímu názoru, že Glaurung nemůže být původní, protože nic není původní; mýty se jen tak trochu mění... a také jsem byl zklamán, že nezabral na druhou půlku mé glosy, která mi připadla důležitější... leč zase off topic.

Pak mi ale začal ten Sigurd vrtat v hlavě, vzal jsem do ruky Montse Sainta (zase - taky co jiného; jiná drakologická česká kniha, pokud vím, neexistuje); a strávil jsem s tím docela zajímavý večer, jehož výsledkem je tento MYTOLOGICKÝ VÝLOV:

1) Veškeré dračí mýty na Evropské straně, pravím; gravitují ke třem zjevným archetypům, které pro přehlednost označuji I,II a III. Samozřejmě existují kombinace a vylepšení o různé detaily... a pokus o křeťanskou verzi draka - ďábla, jenž se moc nechytla.... viz dále

2) Nafackoval bych si - vůbec nevím, proč tu řešíme otázku starobylosti dračí ideje, když nad hlavou máme důkaz nad jiné; souhvězdí draka!!

Obloha byla poprvé popsána, slyšte, starými Sumery, někdy okolo r. 3000 př.n.l., a je to jeden z vůbec nejstarších výtvorů lidské kultury (raritou je Orión - čili Uru anna, světlo oblohy, kde je podoba lovce zachována i s originálním názvem; zřejmě nejstarší vlastní jméno, co vůbec existuje...)
Změny dalších kultur (Řekové, Arabové, doobjevení zbytku oblohy v baroku) jsou celkem minimální; není pochyb, že Drak, kde se nacházela v té době i nejsevernější hvězda oblohy (Alfa Draconis - Thuban), byl zajisté mezi těmi prvními...
a nejen to - Drak tvoří celek s partou souhvězdí Kefeus - Perseus - Kassiopeia - pak tu máme nejstarší drakobijnou scénu na světě, a je to základ Archetypu I, jehož podobu známe z pověsti o Perseovi (pravda, jména jsou řecká, a tudíž vzhledem k úžasnému stáří celé věci relativně zánovní... a kromě toho drakovi tu konkuruje velryba, souhvězdí na opačné straně oblohy z jiných verzí)- nicméně odtud zjevně kráčí dlouhá řada drakobijců přes řeckou Sybaris, toho Sigurda, sv. Jiřího a také Bajaju (specielně pro Frelina...) a konečně i Glaurunga a jeho četné potomstvo.

3) jsme-li už u Řeků, musíme už zakrojit do archetypu II - a tím je alchymie (je mi líto - bude to nevyhnutelně trochu okultní; kdo to nesnáší, ať si zakryje oči). Základ je Egyptský, odtud se to dostalo do dvou proudů - Bible a k Řekům; zde pak máme alchymický Návod, jak to pracovně nazývám, obsažen úplný v prastarých mýtech o Héraklovi a o Argonautech;
právě Řekové do toho vnesli užívání draka jako symbolu... (to je ten ze zahrady Hesperidek, který je též někdy považován za draka nebeského (pak patří k souhvězdí Herkula), a nikoli náhodou skoro stejného draka, jenž hlídá zlaté rouno...
nedosti na tom - ještě je třetí slavný drak, též alchymický, totiž ten Kadmův, jehož zuby byly zasety do země... dál pro opravdové znalce viz fórum hermetismus

4) v křesťanském středověku se, pochopitelně, velmi záhy objevil archetyp I (pár dračích historek tohoto typu se váže ke Karlu Velikému, některé k Artušovi ve staré verzi...) a nikdy nevymizel - v mé knize jsou tu pěkné historky jihofrancouzské až španělské, o dracích z Mont Blancu a o drakovi La Víbria...
a úderem poloviny 12. století a druhé křížové výpravy do Evropy vtrhla také alchymie (typ II), aby zaplavila skutečně kdeco (namátkou - svatý Grál, katedrály, panna Maria, heraldika) - nikoho nepřekvapí, že se objevily i dračí historky alchymické, ne nepodobné těm řeckým (náš Bruncvík, prý původně od Chrétiena de Troyes a jeho Yvaina - mimochodem, tento Chrétien by měl být prohlášen ve fantasy za svatého, hned vedle Tolkiena, neb vynalezl minimálně svatý Grál a Lancelota...)

5) jenže mne vysloveně překvapila síla archetypu III - úplně jiných dračích historek, ponejvíce z Francie, nejméně ze 14. století, který je vysloveně erotický... jde totiž o mnou a Wothanem původně pohrdnutou ideu drakodlaka - tedy draka, který se proměnil v princeznu, nebo v prince, za účelem milostného soužití s člověkem... takové případy jsou Meluzína, Jilocasin, Dračí princové a vůbec idea zlatého draka...
Přátelé, buď to vymysleli Francouzi (to by jim bylo podobné), nebo dokonce Albigenští, nebo je to ještě starší - ale vězte, že v této větvi příběhů jsou draci zásadně hodní (!), a autorům příjde motiv soužití s plazem vysloveně rajcovní... a je to napsané tak, že to má něco do sebe (mimochodem, že to je archetyp, dokazuje to, že bez znalosti čehokoli podobného jsem tento motiv v jednom svém příběhu použil takké.... a také nelze nevzpomenout na jednu nejlepších Sapkowského povídek o zlatém drakovi, též s erotickým podtextem... )

Lady Candar: U tohoto bodu tě volám na pomoc - jdeš mi zrovna do rány! Taky si něco podobného spáchala - mluv, jak jsi na to přišla...!

6) Speciálně po Wothana: - Sigurd
a Fáfni v mé verzi se podobá Glaurungovi evidentně v postavě zrádného trpaslíka Míma... ale to je asi tak celé. Jinak je to v zásadě archetyp I. Ovšem zase mne zaskočila ta alchymie, která tam evidentně nemá co dělat (drak, probodnutý do krku; porozumění řeči ptáků; hrdina se koupá v dračí krvi) - to přece musí být pozdější intoxikace mýtem II, protože před 12. století to nemá v Evropě co dělat... jak je valstně Sigurd a Fáfni starý, Wothane?

A to všechno jen pro rozjetí - vynechávám opět Východ, to je spíš pro Fandu... a ty opeřené hady - tam plavu taky....
Wothan21.3.2003 (11:42)
Argonaut: ke zbytku snad později, ale co to je "v mé verzi Sigurda"? Drak proměněný Fáfnir - původem trpaslík nebo álf, zkrátka skřítek (germ. myth v tom neměla nikdy tak docela jasno), též kouzelník. S Mímirem tenhle mýtus vůbec nesouvisí. Sigurd jej zabil na popud Fáfniho bratra Regina - to byl také skřítek, bájný kovář který jediný dokázal skovat přeražený Sigmundův meč (že ti to něco připomíná?) a to tak že jím přeťal Sigurd Reginovu kovadlinu i se špalkem. Protože se nemohl Fáfnimu postavit čelem (kvůli jedu kterým by ho zahubil), vyhloubil na Reginovu radu díru do které se skryl a bodl draka když lezl přes ni do jednoho z mála slabých míst. Fáfnir ale nezemřel hned - než zemřel mluvil se Sigurdem a defakto jej proklel (to je taky věc verze, ale Fáfniho poklad skutečně nikomu nepřinesl štěstí, jen zkázum a nakonec skončil ve vodách Rýna). Sigurd poté snědl jeho maso (někde jen ochutnal či olízl prsty) a porozuměl řeči zvířat...na udání ptáků že Regin kuje zradu jej Sigurd pro jistotu také zabil, ale Fáfniho proroctví se stejně vyplnilo. V tom mýtu najdeš i celkem málo podstatné, ale zajímavé věci - dračí přilbu děsu atd. To co považuješ za nepodstatnou zmínku je naprosto zřetelná a přímá Tolkienova inspirace (inspirace se samozřejmě nerovná slovu opsal) pro svého draka. Jak říkám - je to velmi známý mýtus, stran draků a germ. mythologie snad vůbec nejznámější, odbít ho takhle strohou poznámkou si nezaslouží :-)
argonantus21.3.2003 (11:57)
Wothan:
no vidíš - nelituji, že se obracím na pravého germánského boha... tyhle podrobnosti vůbec neznám; a inspirace Tolkiena je tu samozřejmě mnohem zřejmější...
taky potvrzuješ moje podezření, že to, co mám já, je jakási novější adaptace - u tebe chybí to důležité bodnutí do krku, i koupání v krvi... porozumění řeči zvířat a řeči ptáků jsou dvě hodně jiné věci, ač to vypadá, jako skoro totéž...(mimochodem, Zlatovláska, že?)

Ještě prosím o upřesnění stran stáří; co jsou nejstarší rukopisy.... a vůbec.
Wothan21.3.2003 (13:06)
Argonaut: zkus si sehnat někde v knihovně Ságu o Volsunzích (ještě by se dali sehnat Ynglingové, Nibelungové jsou už ale o něčem jiném - to už je Německá klasika a poměrně nová věc - 12.st.). Ti Ynglingové jsou přímo z pera Sonrriho Sturlusona, takže nějaké 13.st. ale defakto přepis mnohem starších mýtů (spec. Island je v tomhle směru krásná konzervace). Ty Volsungy seženeš už asi jen v knihovně - v překladu od L. Zatočila (bo to vyšlo 1960). Taky je to překlad ze staré islandštiny (defakto stará Norština) - tyhle mýty mají dost obtížnou dataci, protože zápis je obvykle pozdější a předcházelo mu několik staletí ústní tradice. Mýtus o Volzunzích a Nibelunzích odkazuje až ke dvoru krále Budliho (Attila Hun, náš oblíbený Bič Boží) a odráží se v něm ozvěna skutečných událostí stran vyvraždění kmene Burgundů. Ale i dvůr Budliho v těchto mýtek už je tranformován do podoby Vikingů (v Nibelunzích to už vůbec působí trochu legračně...tedy ne samo o sobě, to jistě ne, ale v kontextu historie nesporně) atd. Takže až takhle daleko ty mýty sahají, ale záznamy jsou mnohem pozdější - nejstarší fragmenty obvykle tuším kolem 9-10.st. Když jsme u toho přeraženého meče, to je také můj oblíbený mýtus, protože odkazuje k jiným archetypům - ten meč se jmenoval Gram. Dostal ho Sigurdův otec - Sigmund (Němci říkají Sigmundovi Siegmund a Sigurdovi Siegfried) přímo od boha Odina - ten se zjevil na hostině (nepoznán jako obvykle - většinou se zjevoval v podobě jednookého vysokého starce v modrém plášti) a zarazil tento meč do trámu s tím že kdo jej vytáhne tomu patří (a nejen ten meč). Jediný Sigmund ho vyjmul bez jakékoli námahy z trámu. Byl to meč ukovaný skřítky, nezničitelná vítězná zbraň. Přesto jej zničil zase Odin když se postavil do cesty Sigmundovi v bitvě, ten jej nepoznal a ťal - Odin nastavil své kopí a Sigmund o něj meč přerazil. Tady je velmi zajímavé srovnání s Wágnerovou verzí v Prstenu Nibelungů - je to zcela jinak. Po Sigmundově smrti jeho žena uchovala úlomky meče Gramu aby je pak Regin znovu skoval dohromady pro Sigurda....tady máš Tolkienovu inspiraci, ale asi to nebyla jediná inspirace. Nicméně je to zjevně také určitý archetyp - tenhle mýtus či spíš jeho kořen známe v mnoha různých podobách - viz. keltský Caliburnus (Excalibur). Mýtus o legendárním meči který přivede krále k vítězství zná snad celý svět - tuším že něco podobného znali třeba i Mongolové.
argonantus21.3.2003 (13:12)
Wothan pro mně dost složitý, ale nadmíru užitečný:

1) Pochopil jsem správně jádro té trajektorie:
Argonaut: zkus si sehnat někde v knihovně Ságu o Volsunzích (ještě by se dali sehnat Ynglingové, Nibelungové jsou už ale o něčem jiném - to už je Německá klasika a poměrně nová věc - 12.st.). Ti Ynglingové jsou přímo z pera Sonrriho Sturlusona, takže nějaké 13.st. ale defakto přepis mnohem starších mýtů (spec. Island je v tomhle směru krásná konzervace). Ty Volsungy seženeš už asi jen v knihovně - v překladu od L. Zatočila (bo to vyšlo 1960). Taky je to překlad ze staré islandštiny (defakto stará Norština) - tyhle mýty mají dost obtížnou dataci, protože zápis je obvykle pozdější a předcházelo mu několik staletí ústní tradice. Mýtus o Volzunzích a Nibelunzích odkazuje až ke dvoru krále Budliho (Attila Hun, náš oblíbený Bič Boží) a odráží se v něm ozvěna skutečných událostí stran vyvraždění kmene Burgundů. Ale i dvůr Budliho v těchto mýtek už je tranformován do podoby Vikingů (v Nibelunzích to už vůbec působí trochu legračně...tedy ne samo o sobě, to jistě ne, ale v kontextu historie nesporně) atd. Takže až takhle daleko ty mýty sahají, ale záznamy jsou mnohem pozdější - nejstarší fragmenty obvykle tuším kolem 9-10.st. Když jsme u toho přeraženého meče, to je také můj oblíbený mýtus, protože odkazuje k jiným archetypům - ten meč se jmenoval Gram. Dostal ho Sigurdův otec - Sigmund (Němci říkají Sigmundovi Siegmund a Sigurdovi Siegfried) přímo od boha Odina - ten se zjevil na hostině (nepoznán jako obvykle - většinou se zjevoval v podobě jednookého vysokého starce v modrém plášti) a zarazil tento meč do trámu s tím že kdo jej vytáhne tomu patří (a nejen ten meč). Jediný Sigmund ho vyjmul bez jakékoli námahy z trámu. Byl to meč ukovaný skřítky, nezničitelná vítězná zbraň. Přesto jej zničil zase Odin když se postavil do cesty Sigmundovi v bitvě, ten jej nepoznal a ťal - Odin nastavil své kopí a Sigmund o něj meč přerazil. Tady je velmi zajímavé srovnání s Wágnerovou verzí v Prstenu Nibelungů - je to zcela jinak. Po Sigmundově smrti jeho žena uchovala úlomky meče Gramu aby je pak Regin znovu skoval dohromady pro Sigurda....tady máš Tolkienovu inspiraci, ale asi to nebyla jediná inspirace. Nicméně je to zjevně také určitý archetyp - tenhle mýtus či spíš jeho kořen známe v mnoha různých podobách - viz. keltský Caliburnus (Excalibur). Mýtus o legendárním meči který přivede krále k vítězství zná snad celý svět - tuším že něco podobného znali třeba i Mongolové.
Fanda21.3.2003 (13:16)
Ad Wothan 21.03.03 09.36:
S tou druhou polovinou se zcela ztotožňuji.
A pokud jde o to snění - řekl bych, že opravdu záleží na tom, kolik toho o daném tématu daný člověk ví - jak bych ti to jen - podívej, třeba ty, nebo Argonantus můžete nakrásně snít o dinosaurech - já už ne. Byvši člověk biologicky vzdělaný (ach jo, co tu ještě na sebe nenapráskám ^_^), je tohle pro mě už formulování hypotéz a to je už něco kapánek jiného.
Ono ani dost nejde snít o době našich předků - přiznejme si na rovinu, že žádný med to také nebyl - špína, mor, cholera, drancování, právo útrpné, atd. - snít se dá jen o tom, jaké by to bylo, kdyby, ...
Ale dosti už toho, protože se obávám, že bysme skončili u toho, že každý máme pojem "snění" nadefinován trochu jinak.

Argonantus: no tak ti děkuji - teď abych otevřel ty Mýty a legendy a Příběhy dračích císařů znovu, protože už je to nějaký ten pátek (sobota, neděle, ...), co jsem je četl a bohužel na to v současné době čas nemám - ledaže byste tak 2 měsíce vyčkali.
argonantus21.3.2003 (13:22)
Do pytle, teď jsem to zkazil.

Wothan ještě jednou:

1) platí, že napřed Budli (Burgundsko), pak Yngligové (island, asi 9. století), pak Volslungové (10-11. století) a pak Nibelungové (12. století), a pak teprve dochovaný zápis?

Celé, co vyprávíš, nese ráz určité důmyslnosti a složitosti - asi to zase tak úplně staré nevypadá (12. století?)

2) Meč sice nesouvisí s draky (i když ne tak docela - mýtus skvělého meče patří k drakobijci dost často), nicméně i zde jsi mi dost pomohl - daří se ti nechtěně oddělit předalchymickou verzi pověsti
tohle mne totiž vždy mátlo - meč v kameni (v trámu, v kovadlině, atd.) nese často jasné odkazy na Mojžíšovu hůl; zřejmě jde ale o dvě různé věci, které se teprve v barvitém 12. či 13. století spojily....

4) Mongoly neumím - i když jsem se jimi nedávno dost zabýval (kupodivu v souvislosti s RPG), neb jsou úžasná záhada (proč vlastně nerozdrtili roku 1241 Evropu? My to vysvětlili v té hře čistě fantasticky - hrdinové ukecali na pomoc draka Nigreona, aten jim pomohl Mongolům namlátit... ale to odbočuji, jen pro potěšení Frelina, S.U.P.a a dalších).
Wothan21.3.2003 (13:24)
Fanda: přijde na to co rozumíš pod pojmem "snít" - ano romantické snění zamilované šestnáctky bude o něčem jiném než naše noční můry :-) Jak bych to jen řekl tobě - my co víme (se vší rezervou která se do slova "vědět" vejde) sníme jak se tomu přiblížit, ale právě pro to že víme, máme představu co to obnáší. Možná jsem masochista, ale snění nemusí vždycky provázet růžová mlha a romantické představy :-)) Se vztahem oboru k fantasii souhlasím - poznatky a znalosti přistřihují křídla fantasii v každém oboru.
argonantus21.3.2003 (13:38)
Fanda a Wothan ještě jednou:

u mne je to zase obráceně. To, o čem nevím lautr nic, o tom nemohu snít (manga, Ynglingové). O tom, o čem vím dost, to mne naopak svádí k přemýšlení, v krajním případě až k umění. Život na hranici reálna a nereálna je mi druhou přirozeností; nutností je ovšem bystře navigovat v různých odstínech reálna, aby člověk nezmagořel úplně...

nejde, o to, že vím o věci moc; jde o to, že jisté věci nemají to, co nemohu nazvat jinak, než jistý magický náboj; duši; však víte, co myslím. V tom je problém Fandovy teoretické židle; je naprosto jasná a není na ní nic zajímavého; kdyby každý, kdo na ní sedí, zmizel, nebo zmoudřel, nebo tak něco, to už by bylo nadějnější...

Kdyby byla na světě jenom čistá věda, svět by byl hrozná otrava; srovnejte obraz 12. století ve vaší školní učebnici dějepisu, a můj obraz kanovníka s drakem...
Wothan21.3.2003 (13:41)
Argonaut: ten mýtus meče v kameni, trámu či kovadlině je sklutečně velmi starý. Co se týče záznamů - první záznamy (alespoň v germ. oblasti) jsou dost pozdní - 9-10.st. Je třeba si uvědomit, že v germánské pohanské oblasti neexistovalo písmo - runový zápis se nepoužíval k běžným záznamům (výjimkou je třeba zákoník v Codexu Runicu) a ani to nebylo třeba - skaldská tradice stála především na ústní formě (ta forma sama o sobě je dost komplikovaná - je to směs mnemotechniky pro uchování a reprodukci a uměleckého stylu). Proto se nejstarší podoba mýtu obvykle nedochovala - pokud byly záznamy obvykle byly ztraceny nebo se dochovaly pouze ve fragmentech - je to celá řada ság. Snorriho zmíněné záznamy jsou pozdní (podobně jako jeho mladší Edda), ale na Islandu přetrvala bez větších vnějších vlivů konzervovaná tradice (a přežila i přechod na křesťanství) skaldské poezie - včetně zmíněných ság a mýtů, takže zaznamenané mýty mají podstatně starší kořeny a asi ani nijak dramatické obsahové změny. Ale nějakou promyšlenost bych v tom nehledal. Nibelungové jsou jiní ani ne tak pro to že jsou z 12.st. (to jsou Snorriho záznamy i mladší), ale spíš proto že pochází z jiné kultury. Autor Nibelungů vycházel z původního strohého mýtu, ten kompletně přepracoval a zapsal ve stylu obvyklém pro styl tzv. "rytířské kultury" (poezie). Všechny postavy dostaly tak nový nátěr, dílo bylo převedeno do soudobém a značně idealizované podoby, počty účinkujících asi zdesateronásobeny...vše je podané ve velmi nadneseném duchu (ála Kolíkovo Účinkuje tisíc slonů) ve zjevné snaze ohromit posluchače. Motivy a jednání lidí jsou upraveny tak aby odpovídaly soudobé dvorské kultuře a přesto z toho stále vykukují původní motivy které do takového díla nějak nepatří...relikty...dost, srovnávat tyhle dvě verze mýtu by dalo na tlustou a nezáživnou knihu :-)
argonantus21.3.2003 (13:46)
Wothan:
ale jo, tady zhruba rozumím. Dovoluji si srovnat sesterského Artuše (původní verze, boj se zlými Dány), a rozšířeného Artuše by Chrétien de Troyes (včetně Lancelota, Grálu, původu z Tróje atd.)

Zvláště mne zajímá nejstarší možná verze Sigurda (to je to, cos vyprávěl?)

Jinak, co ty na Archetyp III - tu drakodlakoidní verzi? Mají Germáni taky něco takového?
Wothan21.3.2003 (14:00)
A k Mongolům (omlouvám se za OT) - to je velmi prosté - Vpád do Evropy vedl Batu Chan. Útočili ve dvou proudech a jejich rychlý postup byl způsoben jednak taktikou - překvapení, rychlý pohyb převážně lehké jízdy, střelci, výborná vojenská organizace. Taky se v prvním plánu nezabývali dobývním pevností které nezískali náhlým přepadem. Jenže jeden proud táhl přes Polsko - roviny, nížiny, ideální. Druhý proud podobně napadl Maďarsko. Ještě 1241 porazili Mongolové u Legnice Jindřicha Pobožného a Templáře (tuhle bitvu jsme společně s kolegy z Německa prošvihli...možná že je to dobře). Dolní proud narazil na tvrdší odpor, proto mu ten Polský vyrazil na pomoc - takže Mongolové protáhli Moravou. Ale protože neměli čas spíš jen zběžně spížovali napadáni posádkami hradů které se ani nepokoušeli dobývat. Což je škoda, protože pokud by obléhali hrady v našem členitém terénu mohli bychom se dozvědět víc o adaptabilit jejich taktiky...na druhou stranu je otázka jestli to je taková škoda, jsem rád že nemám šikmé oči. Ten severní proud se ještě dokázal spojit s jižním a porazit uherské vojsko. Společně pod Batu Chanem pak měli vést úder na Rakousko. Fridrich Bojovný už byl nažhavený na hranicích a i Václav stahoval co mohl na jižní Moravu. No a pak prostě jednoduše zemřel Velkých Chán Ogodaj a bylo po ptákách. Batu Chan se otočil na patě, s ním se na patě otočila celá mongolská armáda a vyrazil domů protože bylo třeba řešit problém nástupnictví a tak stará Ogodaj, tím že natáhl svá perka ve správný čas zachránil Evropu....ačkoli je otázka jak rychlý by byl postup Mongolů dále do nitra Evropy ve stále horších podmínkách a především zda by vůbec dokázali dobyté území efektivně ovládnout a udržet....konec hist. exkurzu...jak říkají tataři - Kesim! :-)
argonantus21.3.2003 (14:10)
Wothan:
já to tady nechci rozpatlávat s těmi Mongoly... ale mně tahleta oficiální verze moc jasná není; vykazuje několik podivností; ta smrt Odadaje mne z různých důvodů nepřesvědčuje jako důvod k tomu, aby zapíchli oslnivě úspěšné tažení v nejlepším...
Batu a po něm Barka neměli šanci na vrchní velení; taky ho ostatně stejně nedostali; časové prodlení šíření událostí po ploše říše je další záhada; říše už se stejně pomalu rozpadala; nebylo by jednodušší dojít ten malý kousek k oceánu (po bitvě u Lehnice a Sajó se střelným prachem...), a pak si v klidu řešit nástupnictví...?

Ale asi to nevyřešíme; nechme ofiiální verzi.

Co ti sexuální draci z Francie?
Wothan21.3.2003 (14:29)
To tažení bylo oslnivě úspěšné spíš v počátku a to z velké části stálo na momentu překvapení. Kdyby severní proud táhl dál k oceánu, byl by jižní proud pravděpodobně poražen, protože odpor na jižní frontě byl mnohem silnější než velmi úspěšná Polská akce. Na jihu by se mohli dostat mezi Uherské a Fridrichovo vojsko i za předpokladu, že bychom se toho neúčatnili my, protože při dalším tažení na Německo by musel Václav držet především severní hranici Čech. Batu Chan by mohl ztratil půl armády, bylo nezbytně nutné aby severní proud stáhl do Uher (alespoň to je můj názor). Takže o pokračování po severní linii dál k oceánu nemůže být řeč. Probíjewt se dál přes Rakousko, Čechy a Německo by je stálo hodně sil a veškerý moment překvapení už byl dávno pryč. I kdyby dokázali porazit zbytek Evropy nedokázali by ji udržet. Hádám, že Ogodajova smrt byla prostě poslední kapka.
Wothan21.3.2003 (14:30)
Sexuální draci Francie mi moc neříkají :-)
argonantus21.3.2003 (15:00)
Wothan:

nedáš-li pokoj, budeme muset založit vlastní fórum... na jihu v bitvě u Sajó podle mne proběhl naprostý debakl Maďarů, pár dní od té Lehnice; podle mých zpráv byli Maďaři z hlediska vojenského prakticky vymazáni z mapy (ještě o rok později si vesele Mongolové hospodařili někde v Dalmácii); jižní armáda Mongolů musela být velká, jako prase (nenapadá mne lepší výraz - mluví se o 90.000 Mongolech, složených původně ze dvou proudů); k tomu se přisypala přez Moravu ta severní armáda (od začátku menší- 30.000 podle pesimistů), takže někdy v dubnu stojí proti spojenému vojsku Václavovu a Fridrichovu asi dvoj - až trojnásobná přesila Mongolů, někde v oblasti Vídně (kdovíproč se tolik důležitých bitev odehrálo tady); za nimi je na Dunaji, vedoucímu do Německa, už jen pár pevností (Salzburg), které možná působí impozantně na středoevropany, ale proti záplavě Mongolů se střelným prachem a raketami je to spíš sranda (když vzpomeneme, jak snadno zatočili s Kyjevem... i s tou Lehnicí...a Krakovem... a když uvážím, jaký debil byl arcibiskup Sponheim...); navíc Říše si stále ještě laskavě nevšimla, že nastal právě konec světa (co by asi tak prováděl Fridrich II, který měl právě někde v neapoli úplně jiné starosti?)...
Mně to přijde spíš šachmat z hlediska Evropy....
argonantus21.3.2003 (15:22)
Projevuji trvalý zájem o sexuální draky z Francie a astronomické draky zřejmě starověké... viz 21.3. ráno
Wothan21.3.2003 (15:28)
Tak to se už asi nedovíme. Pokud by si vyloženě věřili nechápu proč stahovali severní armádu na jih a spojovali oba proudy v jeden. Pravděpodobně pro hlavní úder a ten by šel na Fridricha....nebo v horším případě na Moravu a pak na nás. U říše bych se bál spíš o to že ve své rozdrobenosti by nebyla sto se účinně a efektivně bránit (spíš včas). Přžesto si nemůžu pomoct - i kdyby se probili Evropou (taky by značně prořídli) i kdyby dobyli všechny pevnosti v cestě (i se střelným prachem by ztratili dost času a rozhodně moment překvapení), nebyli by ve stavu vládnout Evropě ani ji celou zničit.
argonantus21.3.2003 (15:36)
Wothan:
Jo. Ale s tím si moc nelámali hlavu... alespoň v případě jiných zemí... z Polska a Uherka tiše vym,izeli do několika let, z Ruska za dvěstě let, z Číny za sto let... já fakt nevím...

Teď jsem objevil maníka na hlavní stránce (komentář článku o dracích), který tam tvrdí, že Slovani znali draky také... tak tohle mi úplně uniklo - vždy se naopak poukazovalo na značný nedostatek draků v Rusku a okolí...
Fanda21.3.2003 (15:39)
Argonantus: A proč si myslíš, že se ve chvílích volna bavím o dracích a spolčených jevech ^_^

Ad. ti Mongolové - ale berte to prosím jako plácání naprostého laika: Věděli vůbec, že ještě kousek a mají na dohled oceán? Krom toho, nám může znít nutnost vrátit se po skonu panovníka z úspěšného tažení jako blbost, ale na druhou stranu, my nejsme Mongolové.
A jen tak na okraj - některým z nás by šikmé oči ani tak nevadily ^__^
Krom toho i tak zde různí asijští nájezdnící zanechali své geny - uvidíte-li někde dívku s dlouhými vlasy až k pasu či dále, pak je téměř jisté, že její praprapra....babičku znásilnit nějaký Asiat.
argonantus21.3.2003 (15:42)
Fanda:

Jo. A ještě nám dlužíš vhled do nitra šikmookých draků... nebo alespoň náhodně vedenou sondu; to bývá také zajímavé.

Jinak - ty bys zrovna možná věděl něco o tom souhvězdí draka...
Wothan21.3.2003 (15:44)
Fanda: no to sice zanechali, ale ne přímo Mongolové-Tataři - spíš jejich předchůdci Avaři a před nimi měli Slované co do činění i s Huny, ale to se nás tady až tak dalece netýká, kdežto ti Avaři nesporně ano. Jaký podíl v genetice zanechali si netroufnu tvrdit - to je spíš tvoje odbornost, ale třeba refelxivní luk jakkoli se tu používal méně byl jejich dědictvím stejně jako hroty šípů nasazovaných na řap (to je obecně asijská záležitost a je zvláštní že se nad tím málo kdo pozastavuje).
argonantus21.3.2003 (15:48)
Potenciálně důležité:

nemohli vnést Mongolové na scénu východní draky? Pokud vím, měli je vyobrazené na raketách... já snad někde najdu popis jejich pyrotechnických strojů od Lehnice, mám pocit, že to s draky souvisí...
a vzápětí Marco Polo a jeho konkurenti... nemohlo dojít ke kontaminaci čínskými draky už zde...?
Wothan21.3.2003 (15:53)
Stroje? Já mám k Mongolům pouze děla, ručnice (velmi podobné našim pozdějším mušketám) a u raket pouze jakési koše na hromadné vypouštění raket - jakési primitivní raketnice. A samozřejmě klasické vahadlové praky. Ale nějaké velké raketové rampy jsem neviděl.
Wothan21.3.2003 (15:59)
Jo, ale mohl bys mi pomoct s něčím jiným - máš někde detailní nákres šípu s píšťalkou?
nojon Džebe21.3.2003 (16:06)
Wothan: Mno, ten mám, ale bohužel ho nedostanu na počítač.
nojon Džebe21.3.2003 (16:26)
Wothan: Špí s píšťalkou - je mi známo, že pískající šípy byly dvojího typu - píštalka ( šlo o jakousi malou kouli těsně pod hrotem s otvory, tak aby za letu vydáli pískavý zvuk ) umístěná pod hrotem šípu nebo hroty s otvory tak, aby pískaly ( jde pak o vcelku zvlášní hroty, které se rozcházejí do dvou menších jako roznožka )
nojon Džebe21.3.2003 (19:04)
Nějak jsem tu propásl ty Mongoly, trochu se k nim ještě trochu zpožděně vrátím.

Rychlý postup - Vcelku zajímavý fígl. Zhruba dva dny před hlavním vojem jelo několik rychlých jezdců/vyzvědačů. Za vojskem kromě zásobních oddílů, dobytka a tak dále, hnala se i stáda koní. Na každého vojáka přidali zhruba 2 - 3 přepřahací koně. Zvědové pak v případě potřeby dávaly signály k výměně koní. Cesta se tak dala zkrátit až na polovinu. Očekával-li tedy nepřítel vojska za 14 dní, byl asi překvapen, když dorazila za 7 dní. Během nočních pochodů se využívala dlouhá kopí coby podpěra jezdců. Na konci kopí byla smyčka, která se přehodila přes špičku boty ( tradiční mongolské boty - gutals, zimní pak boitog ) mají zvednuté špičky, aby zbytečně nekopali do země ) a kopí se opřelo o rameno jezdce před vámi. Mohli tak odpočívat za jízdy a nezdržovat se s přestávkami na spánek.

A světe div se - základní jednotkou mongolského vojska nebyl lehkooděný jízdní lučišník. Lehká jízda ( oblékala bud klasický mongolské oděv "dél" různých typů nebo vesty z ovčích kůží aj., vyzbrojena byla pouze šavlí, lukem a šípy a lasem ) sloužila v zásadě jako poslové, zvědi nebo pro typickou mongolskou taktiku - lehká jízda předstírající útok a provokující nepřítele střelbou z luků lákala nepřátele ke svým oddílům. Tvořili je převážně mladí chlapci a byli to první vojáci, se kterými se nepřítel setkal. Základním jádrem mongolského vojska byl těžkooděný jezdec a v celkovém poměru jich bylo mnohem více než lehkooděných jezdců. Výstroj i výzbroj těžkooděných jezdů je pak kapitola sama o sobě.

Máme-li být upřímní - Bátú-chán měl šance za své zvolení kaganem poměrně velké šance. Čingischán už před svou smrtí sepsal jmenovaní Bátú-chána Džichangirem. Čingischánovo usnesení kdo bude Džichangirem bylo utajeno až do doby tažení na Rus. Velkým sokem mu byl chán Güjük syn Ögodajův. Kaganem se nakonec stal právě chán Güjük, který ovšem poměrně brzy zemřel. Dalším kaganem měl pak být Bátú, ten se vzdal titulu ve prospěch svého přítele Möngkeho a sám se usadil na Rusi ( počátek Zlaté Hordy ( ta se pak rozpadla a další hordy - Bílá horda... ), začal tím tak rozpad jednotné mongolské říše na několik samostatně fungůjících států, často proti sobě bojujících - zejména Zlatá horda s říší Ílchánú a posléze Timurovci ). Vzhledem k velké rivalitě obou chánů ( Bátúa a Güjüka ) by byl pochopitelný takový tah ze strany Bátúa a říše se začala rozdělovat až po smrti Güjüka. Navíc zde byly pokyny z Čingischánovy "Jasy", přikazující po smrti kagana zanechat bojů a na kurultaji zvolit nového. I za takovou dobu mělo ještě Čingischánovo slovo velkou váhu ( ale s odstupem času se na Jasu téměř zapomnělo ) a Mongolové byli ( a jsou ) národem velmi pověrčivým ) Ovšem to je na delší a mnohem složitější debatu, neboť zde pak vysvítají i důvody tažení a s tím i spojená lhostejnost k dobytí Evropy a tak dále.

V udržení Rusi, Číny a Evropy je podstatný rozdíl. Evropa, ač menší než Asie, je kontinentem plným jednoho státu vedle druhého, navzájem více či méně si vojensky pomáhajícím, plný hnusné politky. Udržet takovou jednu zemi v Evropě by bylo téměř nemožné - kromě samotných obyvatel dané země budou otravovat a podmaněným vydatně pomáhat okolní země. Navíc přísun vojáků do Evropy by byl značně problematický. Co se týče Rusi - s odstupem času Rusové proti panujícím Mongolům neměly výhrady. Země byla po dlouhé době jednotná, Mongolové Rusům poskytovali vojenskou pomoc a chránili je. Žádná větší povstání proti podmanitelům nevznikala. Opakem je Čína, kde museli podmaňené obyvatelstvo velmi často vojensky kárat. Navíc v Asii neexistuje, že by např. Chórezm v době kdy Mongolové dobývali Čínu, poslal svou vojenskou pomoc. Každá země bojovala sama za sebe. Ale to je zase na delší diskusi.

Že by Mongolové vnesli na scénu východní draky? Nepřijde mi to jako moc pravděpodobné. Vojska účastnící se tažení do Evropy byli vojáci především z dobytého Chórezmu a Kipčáci. Tedy vojáci odění ve zbrojích spíše ve stylu podobnému Chórezmu ( muslimskému ) a po dobytí Rusi, Rusům než Číně s prvky draků. Na druhou stranu naprostá absence čínských znaků také není moc pravdě podobná. Jinak draci byli vyobrazování na toulcích, pouzdrech na luk ( saadak ), přilbách, přehozech přes koně pod sedlo, nevím o štítech. Pokud se dostal východní drak do Evropy prostřednictvím Mongolů – tak nejspíše z těchto vyobrazení. A co týče raket – v palných zbraní se moc nevyznám, ale jestli myslíte to stejné jako já ( rakety ). Rampa tvořená dvěma dřevěnými podpěrami ( tyčemi ) s vidličkami na konci, do kterých je zasazena další tyč. Ve výsledku to vypadá jako k opékání prasete. Na to jsou naskládány kopí – nejspíše stejné jako se používali do děl – vypouštěné pomocí střelného prachu ( fungující jako dnešní zábavná pyrotechnika ) Konce jsou na zemi ještě podepřeny další tyčí. Nějak mě nenapadá kam by tam šel zobrazit drak.

Počátek tažení Mongolů do Evropy ( podle mých zdrojů ). Tažení se zahájilo třemi proudy –
1)Bátú ( Subudaj-Bagatur, Šejbani, Buruldaj ) s oddílem 300 000 jezdců zamířili do Haliče a pak do Uher.
2)Bocheton, Kadan, Buri s oddílem 30 000 jezdců přes Podolí do Sedmihrad a Moldavie.
3)Bajdar, Kajdu, Ordu s oddílem 270 000 mužů táhl do Polska.
O tomto rozdělení vypovídají listy rýnského palatina Otty a císaře Friedricha II. ( … )
Celá ta kapitola Mongolů v Evropě je opředena samými proč, nevyřešenými otázky, záhadami. Je to plné spekulací a dohad, často nepodložených, vrcholící v porážku Mongolů u Olomouce a Hostýna – to je už záhada jako kruhy v obilí.
nojon Džebe21.3.2003 (20:03)
Wothan: Díval jsem se po tom detailním vyobrazení šípu s píštalkou, ale nenašel. Asi si to už někdy viděl, tak nevim jestli to není zbytečné, ale pokusil jsem se o jakýs takýs náčrt - http://sweb.cz/nojonDzebe/arrow.jpg
nojon Džebe21.3.2003 (20:41)
Ještě k tomu mýtu o legendárním meči - myslím, že to se váže k Hunům a Attilovi.
Wothan21.3.2003 (22:12)
Nojon: k Attilovi taky - i v poměrně podprůměrném filmu na tohle téma to najdeš :-) Je to tak známý mýtus že skoro odkazuje na nějaký archetyp.
nojon Džebe21.3.2003 (22:12)
Ted se na to dívám, ach ty počty - u třetího oddílu, který táhl do Polska jsem se spletl o 100 000 jezdců, má tam být 170 000.
Wothan21.3.2003 (22:19)
Nojon: zkoušel jsem ty otvory posadit kolmo na dřík aby to pískalo podobně jako když pískáš na lahev, ale nefunguje to. Tak experimentuji dál. Tu kouli znám taky jen od vidění, ale nevím jak pesně to vypadá v detailu.
nojon Džebe21.3.2003 (23:07)
Wothan: Jsem v tomhle jenom teoretik. Ale přeci jen jsem něco našel, i když ti to asi nepomůže - http://www.krackow.com/images/whistle_arrow.gif - jde o jinou verzi píšťalky, osobně jsem tenhle typ viděl poměrně menší. Ted si zhlavy nejsem jistý, ale mám pocit, že pro tu píšťalku bude potřeba speciální hrot, tak aby vzduch přes něj a přes píšťalku pískal. Spíš znám samostatné hroty, aby pískaly. Byly dělány z kostí s potřebnými otvory, z mých materiálů jsem napočítal asi 30 typů hrotů.
Argonantus22.3.2003 (10:13)
nojon, Wothan:
geniální - to nojonovo vysvětlení. Takže nás vlastně zachránil posmrtně Čingizchán svým nařízením....!
pokud někdo chce, mohu mu zaslat svůj rozbor boje v Evropě (vedlejší výsledek RPG hry - ona je to vlastně taky málem living history...)

všichni -
ale nyní, pravím, vám, jsou zde Draci - a vy se svými důmyslnými vynálezy odejděte někam k šermu, nebo založte mongolské fórum!

s jedinou podstanou výjimkou:
polský kronikář Jan Dlugosz popisuje v bitvě u Lehnice, že "Mongolové prý vyzvedli na tyči do výšky dračí hlavu, která chrlila na polské vojsko oheň, dým a smrad..."

Hele! Tenhle drak skutečně chrlil oheň! Není ten svět úžasný?
přece jen to mongolské intermezzo k něčemu bylo...
nojon Džebe22.3.2003 (12:34)
argonantus: Čingischánovy pokny v Jase jsou nesporné a v otázce náhlého stažení Mongolů z Evropy hrají svou roli. Otázkou spíše je, jakou měly v dané situace váhu a nakolik k ústupu Mongolů přispěly.
Určitě mi pošli ten rozbor, rád si to přečtu.
Nemáš u toho citátu z kroniky i vysvětlení, co to bylo za zbraně? Moc mne nenapadá co by to mohlo být. Snad vahadlové praky se lžící vrhající nádoby s výbušným obsahem, na kterých by byly zobrazeny dračí hlavy. Rameno by tak vyzvedávalo do výšky dračí hlavu, doutnající a při dopadu chrlící ohěn.

Wothan: Nemáš vyobrazení, popis těch mongolských děl, raket a ručnic?
Wothan24.3.2003 (8:33)
Nojon: mám, ale něco je dost nekvalitní - kdyžtak ti to nascanuju a pošlu, když pošleš adresu kam to chceš, ale nejsem ani trochu rychlý. Nebavili jsme se o tom už kdysi dávno?

BTW: díky za upřesnění těch počtů, já jsme si bůh ví proč vždycky myslel že severní proud byl větší.
argonantus24.3.2003 (8:46)
Pod vlivem Wothan jsem se zahleděl do severských balad... a co nevidím:
Drak je tu dost častým aktérem (zejména v Norsku), což asi nikoho nepřekvapí; co mne ale překvapilo velmi, je to, že draci se s dámami chtějí většinout OŽENIT, nikoli je sežrat... někdy k pramalé radosti dotyčných dam (a ty si na ně zjednávají lidské zabijáky), jindy se drak mění v prince...
že by vliv Francie?

Jinak - trochu jsem byl nucen změnit názor na ty ohněstrůjné draky. Možná to není jen výmysl prostý. Ten umělý drak od Lehnice je jeden z příkladů... je tu zřejmě souvislost s ohnivými zbraněmi i s Wothanovou sírou.
Další možností je prostě omyl - lze si splést jistou alchymickou vodu s ohněm...
Wothan24.3.2003 (8:58)
Oni si seveřané nikdy moc nelámali hlavu s technikou - někde jsou ti draci jen jednou z několika podob určité bytosti a protože mezi nimi nechybí lidská je to technicky možné, jinde se tím prostě nezabývají (vážně by mně zajímaly jejich představy - myslím tím čistě technické - o křížení druhů :-) ) - konečně co chtít od národů, které věřili že bůh Heimdall má několik matek (snad 8?...zapoměl jsem).
nojon Džebe24.3.2003 (9:21)
Wothan: Pošli to na poor_hero@centrum.cz, díky moc. Pokud si dobře vzpomínám, tak jsme se bavili jedině o Skotech.
argonantus24.3.2003 (9:29)
nojon Džebe:
nezlob. tady jsou draci.

Wothan:
u mýtu jde spíš o podstatu, než o technické provedení. A v zásadě by posloužilo k archetypu III asi i jiné monstrum, než drak (princip Krásky a zvířete - to je zase to samé). Nicméně drak je nestvůra par excellence, takže proč ne rovnou drak...

poznámka na okraj - nenacházím na dávném severu jediného ohněstrůjného draka. To vše je voda na můj mlýn - oheň se spojil s draky někdy okolo roku 1200 nejdříve, možná i později.

Tak mne napadá... proč je vlastně drak nestvůra par excellence? Chápu, proč je králem zvířat lev (jindy tygr nebo medvěd); proč je ale drakovi přiřčena ato málokdy zpochybněná suverenita mezi všemi fantastickými bytostmi? A to platí až po prakticky všechny současné RPG, včetně toho S.U.P.ova HoMaM...
Wothan24.3.2003 (10:18)
Argonaut: nejsou tam - i ten Fáfnir chrlil pouze jed.
argonantus24.3.2003 (10:29)
Wothan:
no právě - stejně, jako všichni jeho ohněprostí kolegové.
Jediná podezřelá výjimka je jedna nedatovaná verze Tristana a Izoldy (snad nejsložitější mýtus ze všech), kde toho prvního Tristanova protivníka nahrazuje drak, a Tristan mu napřed uhasí oheň pomocí měchu s vodou... pak se z toho vyvinulo něco jako Zlatovláska (což je určitě původně jedna z větví Tristana). Ale ani tahle věc nevypadá starší, než tak 13. soletí, není-li ještě pozdější...

moje otázka - proč je vlastně drak králem fantastických potvor - trvá; nějak mne nenapadá vysvětlení...
Wothan24.3.2003 (11:09)
To je otázka - je velký, nebo obvykle bývá velký (ačkoli třeba v řecké ikonografické tradici nijak velký není - zvětšení ústřední postavy - např. sv Jiří toho draka celkem umenšuje), nesporně je nebezpečný, není snadné ho zabít (pevný krunýř, případně nezranitelné tělo až na nějaké ty slabiny aj.), obvykle bývá okřídlený a dostat tohle monstum do vzduchu tak by také nepochybně bylo králem oblohy (kde by byla orlice...byť i dvojhlavá?) a i bez ohně to je velká tlama plná zubů, spáry a velmi často jed nebo alespoň otrávený dech.
darkelf24.3.2003 (12:09)
Darkelf: assi vám naruším sstrukturu, ale

Kosstění draci, lichové: Není známo ani ve fantassy ssvětě, že by exisstoval tak mocný Humán, který by ssvoji mysslí ovládl myssl Dračí. To sstejné platí i o duši. Je to ssice jeden z největších nekromantsských ssnů, ale sspoutat tak ohromnou a divoukou ssílu, která patří přírodě nelze. POkud sse to však podaří, Drak ssvou moudrosstí a magii donutí Nekromanta k šílensství a ssebezničení.
To sstejné platí nepochopitelně i pro bohy, i ti nekromantští nemají nad mrtvými draky moc.
V Podtemnu sse vypráví, že exisstují Dračí kulty, sspolek Hmánů a jiných tvorů, kteří sse ssnaží zísskat abssolutní nessmrtelnosst pro ssvého pána, Draka. Tito draci použijí jejich ssílu a magii a za pomoci tajemného rituálu sse promění do sstádia rozkladu, vznikají Dračí Lichové. Po ssmrti sse vnitřní magie koncentruje v kosstech (tudíž menším objemu a je mnohem divočejší a rychlejší). Taky jim to dává určitou možnosst dožívat sse sskoro nessmrtelných věků na Pláni negativní energie,
chráněni před mocí Bohů.

Mrazivý dech: Argonantuss: Já mysslel, že jssi ssi ten článek přečet. Tam pssali, že drak vydechuje obrovsské množsství kaplaného plynu na oběť. Pssali tam dussík, Já bych sse sspíše přimlouval k methanu (který tam používají míssto acetylune, který jssem navrhl na ohnivý dech: ale acetylen je mnohem výhodnější). Mno a draci dokáží v nějákém orgánu, ssnad i v plicích sstalčit pohyby prssního a žeberního ssvalsstva objem plic tak, že dochází ke zkapalňování plynu, který sse pak vlasstním tlakem při ohřívání vyhrne z jeho ússt. Chtěl jssem ssi tyhle věci propočítat, ale víkend jssem sstrávil ss Drowími bohy a anatomii Drow:-)
Tahle teorie ale dokazuje, že mohou používat obě dvě techniky zároveň, ale na sseveru, díky tomu, že jako iniciátor plamene jssou enzymy v sslinách, které sse ssamovznicují už při 44°C, je metoda ohně poněkud nevýhodná. Možná pokud by ssi to zapaloval ssirkama.
Dále to nevylučuje ani ohnivé draky, protože, jak kombinace acetylenu nebo methanu ss kysslíkem v kapalném sstavu, oheň nevylučují, by dokonce hořlavá rychlesse rozpínající kapalina udělá větší "nepořádek" než obyčejná exploze plynu.
argonantus24.3.2003 (12:17)
Wothan:
no jo, ale proč je tak obrovský a silný?? Proč se vášně všech mýtotvůrců, počínaje Řeky nejméně, nesoustředily třeba na sfingy, gryfony nebo mantikory (i když to také nejsou žádní saláti?)
argonantus24.3.2003 (12:25)
darkelf:
s tebou je to složitější. Jen krátce - pak musím obědvat:

Živého draka ovládnouti - o tom jsem skutečně neslyšel, souhlasí. Ale co s mrtvolou? Ta už přece žádnou vůli nemá...

Dračí lichové nevypaají nezajímavě...

Ohnivý a Mrazivý dech: jo, přečet. Jenomže jsou to dvě úplně odlišné věci. Mrazivý dech se mi stále ještě jeví být Tolkienovou inovací, vynalezenou jako protiklad draka ohnivého (i když už jsem se minule úplně zbodl s tím drakodlakem - tam vymyslel Tolkien jen slovo, nápad je pradávný...)
Technicky by drak skutečně mohl mrazit dusíkem - i když tlakoé nádoby uvnitř draka... vypadá to dot složitě.

S ohněm jsem našel ke svému vlastnímu překvapení ten skvost v bitvě u Lehnice; pak je tu tak alchymie; pak je tu ten Tristan; pak je tu řecký oheň (stále ještě do věci nezapojený); pak je tu ta Wothanova síra. Nejen, že by to snad při troše snahy šlo technicky, ale jsou pro to i matné doklady myytologické (i když se objevují jaksi najednou, v určité době).
Wothan24.3.2003 (12:36)
Argonaut: trochu off topic, ale asi to budeš znát a kdyby ne aspoň to pobaví, je to stažené někde z netu:

...Je zapotřebí smísit červenou měď, prášek z bazilišků, lidskou krev a ostrý ocet. Do podzemního kamenného domu umístíme dva kohouty, a ti nakonec snesou vejce, které vysedí ropucha. Z vejce se narodí dva kohoutci, kterým časem narostou dračí ocasy. Kohoutky potom zabijeme a spálíme, popel se rozetře na prach a přidá se třetina krve ryšavce, vysušené a dobře rozetřené. Vše se smísí se silným octem. Potom se do roztoku vkládají rozžhavené plátky nejčistší červené mědi a nechají se v něm tak dlouho, dokud....

Usekl jsem to schválně, víš o co jde? :-) Pak to sem hodím celé.
Wothan24.3.2003 (12:37)
Darkelf: co ta tvoje fantasy-mythologie? Ptal jsem se čí je to dílko...
darkelf24.3.2003 (12:37)
Argonantus:
Jen ssem ti napssal názor na ledový dech....nic víc nic míň, já v tom nehledám hisstorii.

Jassně, že by mohli obživit kosstru, ale ta není zdaleka tak nebezpečná jako Dračí mrtvola ss duší a vnitřní magii! A proto sse nekromanti povětšinou ssnaží udělat nemrtvé z těch, které ještě duše neopusstila (na bojištích atd.) Protože je pro ně jednodušší jím říct příkaz než ovládat magií každý kloub jejich těla! Mrtvoly bez duší jssou jakssi pomalejší a bez náznaku nějaké obratnossti.
Pouze bohové a jejich kněží mohou navracet duši. Tam je to pak jiná píssnička. Ale Draci jssou proti tomu chráněni, nebo Bohové assi ví, že by to nebylo moc zdravý!
darkelf24.3.2003 (12:53)
Wothan: Něco z Forgotten Realmss a něco moje Hlavka!
Wothan24.3.2003 (13:31)
Darkelf: to je nějaká hra?
darkelf24.3.2003 (13:36)
Wothan: Kdo hledá, je pro něj možná cessta k nalezení!
Wothan24.3.2003 (13:47)
Tak zase tak moc mne to nezajímá, ale vyhledat to samozřejmě můžu. Já jen že se v tom evidentně vyžíváš, takže to muselo dát dost práce ne? :-)
darkelf24.3.2003 (13:50)
To dalo!
argonantus24.3.2003 (14:22)
Wothan:

evidentně se mne pokoušíš dostat... přiznávám bez mučení - tuhle věc konkrétně neznám, ale připadá mi to jako autor, obeznámený se základní alchymickou terminologií, kterou motá víceméně dovedně dohromady... a vůbec by mne nepřekvapilo, kdyby na toho citátu byla nějaká úplná konina (není to Pratchett?).
Ta červená měď a ostrý ocet by ušly; lidská krev je netypická (užívá se krev s jiným označením - nejlépe krev panny, nebo tak něco); prášek z bazilišků je podezřelejší; a ten kamenný dům taky nic moc... jinak je tam málo barev.

Jinak - Forgotten realms jsou snad nejznámější RPG svět vůbec (snad s výjimkou Tolkiena); je na to licence někdy od sedmdesátých let (nevím čí), patří to ke hře Dungeons and Dragons (o té jsi musel slyšet i ty, i když s tím nesouhlasíš), a Darkelf tě tahá za fusekli.
argonantus24.3.2003 (14:25)
Darkelf:
jinak ty nekrohrátky patří spíš k upírům...
Wothan24.3.2003 (14:38)
Argonaut: no nejspíš snažím, ale spíš se tak nezávazně bavím. Co ti říká spis: Schedula diversarum Artium od mnicha Teofila Rugera?
Wothan24.3.2003 (14:41)
Našel jsem to kdysi dávno na webu, ale protože v tomhle oboru nejsem zrovna moc kovaný (i chemie mi trestuhodně málo říká), ptám se. Plné znění toho je:

Přes všechnu mnohotvárnost a "zmatenost" však některé alchymické receptury nepostrádají logiku. Podle jedné z nich je zapotřebí smísit červenou měď, prášek z bazilišků, lidskou krev a ostrý ocet. Do podzemního kamenného domu umístíme dva kohouty, a ti nakonec snesou vejce, které vysedí ropucha. Z vejce se narodí dva kohoutci, kterým časem narostou dračí ocasy. Kohoutky potom zabijeme a spálíme, popel se rozetře na prach a přidá se třetina krve ryšavce, vysušené a dobře rozetřené. Vše se smísí se silným octem. Potom se do roztoku vkládají rozžhavené plátky nejčistší červené mědi a nechají se v něm tak dlouho, dokud měď nepřijme barvu i váhu španělského zlata. To je autentický text spisu z konce desátého století, který sepsal jakýsi mnich Teofil Ruger pod názvem Schedula diversarum Artium. Popel z bazilišků není nic jiného než oxid zinečnatý a účelem nového procesu je vyrobit mosaz, tehdy nepříliš známou. Známe i významy dalších kódovaných výrazů. Orlí perutě znamenají salmiak, těkající, tedy "létavou" látku, zeleným hadem se pro jistotu rozumí červený oxid železitý, a pokud si had požírá vlastní ocas, je to rtuť. Tříhlavý drak znamená prvotní pralátku, ohnivý drak znamená síru atd.
Wothan24.3.2003 (14:45)
Myslel jsem že pro tebe bude zajímavá hlavně ta datace toho spisku, ale protože už ani nevím odkud jsem to vytáhl (narazil jsem na to při hledání historie výroby mosazi) není to žádný relevantní důkaz ani argument, spíš zajímavost.
argonantus24.3.2003 (14:48)
Wothan:
"text spisu z konce desátého století, který sepsal jakýsi mnich Teofil Ruger pod názvem Schedula diversarum Artium" - !?!?
To fakt někdo našel něco takového z desátého století??

Nebo ex post někdo tvrdil, že to psal někdo v desátém století? Já byl na počátku hotov zavrhnout i toho Artéfia - kdybych neměl tolik podobných dokladů od poloviny 12. století, počínaje Královským porálem v Chartres (což je těžko ignorovatelný obejt...), a kdyby nebylo toho Bacona...
Bohužel nejsem jazykový machr, takže nevím, co znamená v řeči ptáků "Ruger" - ale obávám se, aby to jméno nebylo něco takového, jako Abraham Žid, nebo Christian Rosenkreuz... už ten Teofil vypadá trochu podezřele... ale tady zase děláme něco, co patří na "hermetismus", i když oni se z toho nějací draci brzy vylíhnou...
argonantus24.3.2003 (14:58)
Wothan:
jelikož se to tu zjevuje v dost nesmyslném časovém pořadí, tak odpovídám na tvoji předchozí zprávu - jo, myslel jsem si to; spáchal to nějaký renesanční koumák, co to ex post označil za staré, aby oblbnul takové týpky, jako ty a já, co roztají, když je to uleželé...

Podle všeho mého nejhlubšího vědomí a svědomí v 10. století nemá alchymie v Evropě co dělat (tedy nikoli tak v Arabském světě; tam měli náskok, ale pak toho nějak nechali).

Zpátky k tématu - jako jeden z prvních příspěvků na tomhle velefóru vůbec jsem uváděl základní typy užití draka jako alchymického symbolu... takže víceméně souhlasím. Chemie je při ztotožňování symbolu s konkrétní látkou často spíš na škodu (oni taky neznali jinou terminologii, než tu svoji vlastní - prostě pracovali se lvy a draky, ne s oxidy - to je, co, Darkelfe?)
Wothan24.3.2003 (15:00)
No a co o tomhle spisu tedy víš konkrétně? Mně by zajímalo kdo to napsal a jestli to technicky jako výroba mosazi funguje? Ne že bych to zkoušel, přece jen to asi nebude optimální postup, ale jsem prostě zvědavý.
argonantus24.3.2003 (15:11)
Wothan:
o tomhle spisu jsem v životě neslyšel, a za podezřelý ho mám (kromě té podivné datace) proto, že toho velikána necituje nikdo z jeho kolegů (je to totiž jedna z nejjednodušších kontrol - alchymisti na sebe s oblibou odkazují navzájem), tedy například ho nemá Flamel ve 14. století, který sešrotoval dost poctivě vše, co měl k dispozici.

Převody symbolů do jednotlivých prvků jsou zákeřná věc, pravím; skoro každý alchymista užíval symboliku vlastní; a každý s oblibou mátl zejména tím, že stejnou věc nazýval různě (a dvě různé věci zase stejně); symbolický jazyk tohoto typu podle mne nejde rozluštit ani moderními dešifrovacími metodami (...s nejednoznačnými významy je prostě těžká práce). Takže - pokud si je neznámý internetista jist tím překladem symbolů, tak to fungovat bude... a pokud ne, pak je to mimo... například tříhlavý drak coby prvotní matérie mi nějak nesedí...
argonantus24.3.2003 (15:15)
Wothan:
jo, a abych nezapomněl - mosaz většinou není mosaz...
Fanda25.3.2003 (12:18)
Argonantus a další šikmooko-zvědaví: budete si na to muset nějaký ten pátek počkat - jsem rád, že si urvu čas na to, abych tuhle konferenci četl a občas něco přidal...
darkelf26.3.2003 (13:42)
Wothan: zítra ssi to sstáhnu a zkussím sse na tu výrobu mossazi přess výkend kouknout!
Wothan26.3.2003 (14:29)
Darkelf: dík, zajímá mně jestli to je vůbec možné.
argonantus27.3.2003 (0:45)
Wothan (a taky Darkelf):
Možné to asi je; vtip je ale v tom, že je možné něco jiného, než ty od toho očekáváš.
Mosaz je totiž také Venuší, v červené suknici, podkasané zelenou, jak upozorňuje Basilus Valentin. Je to jen další symbol.

Když už alchymie, tak symboly dračí; zmínil jsi rtuť (drak, kousající se sám do ocasu). I tohle má háček; není rtuť jako rtuť. Aby řada vycházela tam, kam má, musí se rtuť lišit od jiné, která by vedla k jinému výsledku (Darkelf je profík, už tuší).

předvedu na pěkném textíku k drakovi v kruhu(byť trochu pozdním - jakýsi pan Labsprinck, vydáno 1678):
Strašlivý drak nanejvýš jedovatý, jemuž nic neunikne, přebývá v lese.
Ten, spatřiv Slunce paprsky a zářný oheň, ihned vypouští svůj jed
a poletuje tak příšerně, že žádný z živých tvorů mu neodolá,
ani sám bazilišek se mu nevyrovná!
Kdo ví, jak jej moudře zahubit, ten ze všech nebezpečenství vyvázne. Všechny drakovy žíly a barvy se při jeho smrti rozmnoží
a z jeho jedu povstane nejvyšší lék.
Jed svůj velmi rychle stráví, požíraje vlastní jedový ocas;
toto vše je nucen provést sám sobě.
Z něho pak vytéká chvályhodný balzám.
Popatři přeci na tyto síly a všichni moudří se neobyčejně nad nimi zaradují.

Užijte si to!
S.U.P.27.3.2003 (9:01)
A darci nám pomalu umírají.
argonantus27.3.2003 (9:31)
S.U.P. (a taky Wothan)
Neblázni. Draci hned tak neumřou - jsme stále na počátku. Jen jsem musel na pár dní pryč. Právě jsem se chtěl ponořit do draků vícehlavých, čili saní... když tu Wothan na jiném fóru vytáhl franskou dračí standartu - kde vzali Frankové draky? Od Vikingů? Od Keltů? To pro ně nebyl drak zlo?
S.U.P.27.3.2003 (9:37)
Nemyslel jsem tim umírání draků jako tech doložených a rozebíraných na tomto foru ale spiš to že se toto fórum nějak odklonilo od draku..

Viz historie Frankové ..... netušim historie není muj obor ja se raději věnuji tak nějak představám jak asi vypadají draci co dělají jak by se mohli domlouvat. Co jedí rádi (třeba temné elfy obry nebo raději princezny)?
argonantus27.3.2003 (9:49)
S.U.P.
Tohle monstrózní fórum se - stejně jako jiná monstra (elfové, Bůh) už mnohokrát povážlivě vyklonilo ze své trajektorie, ale nikdy to nebylo úplně ke škodě; například ta mongolská odbočka vedla k senzačnímu nálezu skutečného ohněstrůjného draka (viz dole), alchymie také nemusí být úplně marná.

Ale abych uspokojil tvůj hlad po dračím hladu:
Drak pociťuje - podobně jako člověk - hlad dvojího druhu. Ten první, jaksi technický, je dán tím, že drak musí něco žrát, a je dravec. Nic objevného na tom není. O mnou předpokládaném pravěkém předchůdci draka se myslí, že lovil tvory střední velikost v bažinách, které přepadal podobně, jako dravý pták; o Marešem předpokládaném současném draku platí, že žere hlavně opice a jinou stromovou havěť (což je dost složitý a zajímavý lov, neb opice není blbá); zdrcující většina draků mýtických a středověkých nepohrdla nějakou tou ovcí či dobytčetem. Jak říkám, nic překvapivého.

Pro literáty byl ale vždy více zajímavý ten druhý hlad, jaksi duchovní - draci prý milují poezii, hádanky, záhady, magii, krásno (zosobněné diamanty i slečnami). Zalistuješ-li trochu dolů, shledáš, že řadě pravých středověkých historek drak slečny nepožírá, nýbrž se s nimi chce oženit (a možná i fyzicky milovat) - odtud několikrát řešený problém drakodlaka, kterým jsme vlastně začali, a který se vrátil na scénu někdy minulý týden.
argonantus27.3.2003 (10:55)
Takže - jaký máte poměr k vícehlavým drakům (saním?)
S.U.P.27.3.2003 (10:56)
Takže saň je vlastně samice od draka.

No a pokud má taková saň více hlav tak může uspokojovat i více draků.
Wothan27.3.2003 (10:58)
Já mám radši draky jednohlavé, hydra není můj oblíbený mazlíček. Zato si vždycky vybavím větu z jednoho legendárního dílka "A co já?! řekla třetí hlava a začaly se prát" - odkudpak to je? Kdo to ví?
argonantus27.3.2003 (10:59)
S.U.P.
Spíš ne. Saň je původně heraldický termín pro vícehlavého draka. Pokud vím, většina fantasy se shoduje, že saň - coby vícehlavý drak - je prostě jiné zvíře. Nicméně spousta pohádek používá výraz drak i v takovém případě...

sexuální uspokojení více draků těžko, ledaže by šlo o orální sex...
argonantus27.3.2003 (11:00)
Wothan:
karel Čapek, Devatero pohádek. Ne?
Jinak já mám ještě radši - ze stejného zdroje:
"... a bude po ptákách," dodala sedmá hlava.
Wothan27.3.2003 (11:01)
Tam taky, ale tohle je z Křemílka a Vochomůrky! :-)
S.U.P.27.3.2003 (11:01)
a pak jedli lívance nebo je to jiná pohádka?
S.U.P.27.3.2003 (11:03)
no abude další oslava 400.....hodně štěstí zdraví....
darkelf27.3.2003 (11:14)
Argonantus: vícehlavosst dračí přenechávám hydrám.
Pro mě je ssaň jiný druh draka (bez křídel)!
argonantus27.3.2003 (11:16)
Wothan:
jo vidíš, na ty jsem úplně zapomněl. Tam je to taky. "BYL TO DRAČÍ OCÁSEK, VY CHYTRÁCI!"

Jinak souhlasím i s tím, že saně nějak souvisí s hydrou... a se draky se možná skutečně zmotaly spíš dodatečně.

S.U.P.
máš nějakého zvlášť oblíbeného draka? K těm narozeninám, například?
Fanda27.3.2003 (11:29)
Lov opic: opice se lovit dají - ostatně po světě jsou na to specializovaní 2 dravci - orel opičí (tuším že z Asie) a harpye (Jižní Amerika) - zajímavé je, že oba vypadají podobně - mají taková dlouhé pera na hlavě - snad proto, aby se opice lekla. Draka by se asi lekala tak jako tak...

Vícehlaví draci: je zajímavé, že jsou známí i v Japonsku (ostatně je to zmiňováno i v té dračí Pevnosti) - jak se dostali do tamních končin, mi je celkem záhadou - ta pověst byla o jakémsi vícehlavém drakovi, který nějak škodil, než mladý samurai umístil sudy s čímsi tak, že drak musel každou hlavu prostrčit jedním oknem, aby se k obsahu sudů dostal. Schovaný samurai mu pak hlavy usekal. Tato pověst je zajímavá i tím, že zde ten drak je zde evidentně onen archetyp I (bestie), zatímco mi přijde, že na Dálném Východě byl mnohem častější archetyp II (mudrc, učitel) - pokud si tedy to dělení na archetypy ještě dobře pamatuji.
nojon Džebe27.3.2003 (11:32)
Argonantus promine.
Wothan: připomínám se na ta děla, ručnice a rakety.
darkelf27.3.2003 (11:35)
400
argonantus27.3.2003 (11:36)
Fanda:

Lov opic: nevím, zda je náhoda, že uvažuješ úplně stejně, jako ten Mareš v souvislosti s kongamatem... ten také vzpomněl na orla opičího, orla harpyji a ještě něco podobného afrického...

Vícehlaví draci:
tvá historka je moc zajímavá, a nějak mi připomíná něco evropského... je možné, že to je převzatá pohádka (z Japonska? i to by bylo možné...)

Lovím svoje pracovní rozčlenění archetypů - I je ta hnusná bestie, kterou je třeba zabít; II je bestie lchymická; tedy jen zástupný obraz za něco úplně jiného...
drak coby mudrc bude asi muset dostat samostatné číslo - IV. Procházím všechny své minulé výlovy, ale evropského draka - mudrce kupodivu nenacházím... nejvíc se tomu podobá moudrý Jilocasin, žijící údajně za Karla Velikého, ale ten se oženil... a sklouzl nám do archetypu III, protože o to tam jde především...
argonantus27.3.2003 (11:38)
Wothan:
a já se připomínám s franskou standartou (o něco dříve zde).
darkelf27.3.2003 (11:39)
Nojon: Ne šermúúúúúúú....
argonantus27.3.2003 (11:46)
... a možná by neměla zapadnout Darkelfova poznámka k vícehlavým saním -NELÉTAJÍ. Opravdu mi to tak připadá. A respektuje to i moderní DrD. Zmatek v tom dělají jen pohádky, a to ještě dost novodobé (ten hnusný Troška).
Wothan27.3.2003 (11:50)
Argonaut: myslím že i v ruských Bylinách jsou vícehlavé létající saně.
darkelf27.3.2003 (11:56)
Wothan: jssou, ale v Rusských bájích mě sspíše připomínají ptáky než plazy (ssice bez peří, ale ta ptaší hlava sse zobákem)
argonantus27.3.2003 (11:57)
Wothan:
reaguji na Wothanův skoro polední projev na elfech - nikoli proto, že bych byl fanda draků, ale proto, že si myslím, že to systémově patří víc sem, protože tady jsme to už jednou začali řešit.

Neúčelnost ve fantasy mi vadí taky. Není problém v tom, že nadbytečné hroty na válečné sekyře by vylučovalo nějaké pravidlo - vždyť fantazie by neměla mít hranice - ale to, že ty hroty jsou nekonzistentní, neúčelné, nesmyslné - a tudíž vlasně ne hezké. Ten člověk neměl fantasie příliš mnoho, ale spíš byl lajdák, že to byl líný domyslet.
Slavná je případ Leonardova anděla - ten obraz fancinuje mnoho lidí tím, že ten anděl nemá řídla "tak nějak nalepená", ale vychází ze studie ptáků, a dělá dojem, že narozdíl od zdrcující většiny andělů by mohl fakt létat... takže je tím zajímavý a krásný. O to mi mimochodem šlo na počátku rozboru draků zde (není to tak moc off topic, S.U.P.e - naopak, jde to ke kořenu věci).
Vadí mi ale také druhý konec hole, který Wothan nezmínil - fantasy je ve skutečnosti fantasie, kde se nesmí skoro nic. Musí se tam řešit jenom různé způsoby zabíjení; magie je omezena jen na stanovená schémata; běda, když se nějaký hrdina zamiluje, a hrdinka neskončí rozsekána na hadry; ať je to královna nebo upírka, musí se jí prsa drát z výstřihu... atd.
Historie je proto pro přežití fantasy životně nutná. Stejně jako skutečný svět prakické zkušenosti, vlastní pokusy a záludné otázky, které ještě nikdy nikdo nepoložil...
Wothan27.3.2003 (13:24)
Darkelf: nebude to spíš těmi ilustracemi? :-) Taky je mám od dětstí vypálené do mozku :-))
argonantus27.3.2003 (13:27)
Wothan i Darkelf:
nejsou náhodou ruští draci (nebo jsou to saně?) potomci řeckých mýtů o hydře? Tedy - není vícehlavost draků naopak východnější evropská specialita (ta Fandova nová historka by tomu odpovídala...)
Wothan27.3.2003 (13:33)
Argonaut: možné to je - čistě kulturně může být spousta věcí v Rusku kombinací řecké (Byzanc) kultury a tradice Asijské (Mongolové-hordy) takže ani v případě mýtů a tedy i draků to není vyloučené.
argonantus27.3.2003 (13:38)
Wothan:
takže potom my, Čechové, jak známo na hranici mezi oběma světy, si můžeme spokojeněužívat obou dračíh varant, která se nám v pohádkách mísí v divokém zmatku (a v poslední době s převahou Západu vedou ve fantasy jednohlaví draci...)

nicméně ještě jednou tě prosím o skok k té franské dračí standartě - úplně mi uniklo, že by Frankové takové znamení užívali... to měli od Vikingů?
Wothan27.3.2003 (14:12)
Argonaut: to asi těžko - Frankové byli na vyšším stupni vývoje, neměli potřebu se učit od Vikingů ani od nich většinou nic přebírat, vypadá to na domácí tradici. Ta standarta je možná spíš had než drak - má to dračí hlavu, ale vlající tělo. Pravděpodobně je ta hlava plastika, protože je upevněna na tyči a vlající tělo je textilie. Napadá mne velmi odvážná myšlenka že by mohl jít o římský relikt - některé pomocné sbory používaly jako signum draka na žerdi - draconis. V tomhle případě by to nebyl náhodný odkaz - franské vojenství a to jak merovejské tak karllovské těží z pozdní Antické tradice i v jiných směrech a tady je zjevné usazení plastického prvku přímo na žerď - korouhve a praporce mají jinou konstrukci. Jinak ty draky najdeš třeba ve Zlatém žaltáři, bibli Karla Holého a dalších franských iluminacích.
darkelf27.3.2003 (14:18)
Wothan: Víš, že máš vlasstně pravdu?
argonantus27.3.2003 (15:12)
Wothan:
vidíš, to je další větev dractví, která mi úplně unikla. Tak nějak jsem předpokládal, že románské (a i o trochu starší, karolinské například) umění vzalo své draky od keltů (kodex z Lindisfarne a jiné výtvory). Vůbec mne nenapadlo, že i Římani mohli mít draky... kteřížto by je zase měli asi od Řeků (viz výše - jsou tam tutově draci modelu I. i II.).

Drakologická mytologie se nám tím ovšem spíše zamotává. Už mne napadla pochyba, zda řečtí draci vůbec létají, a zda to nejsou vlastně hadi (pokud si dáš práci a vlezeš k mému mytologickému výlovu, jediný slavný antický drak nutně létat nemusel); odtud by nemuseli létat draci Římanů, a potažmo ani Franků.

Ovšem tím divnější je, jak přišli Řekové k létajícím saním (a nebo to zase až ti Rusové, kteří si vypůjčili od Řeků mnohohlavost hydry, a od seveřanů létání...?)

Prolezlost evropské mytologie draky je prostě k neuvěření; je jich tam ještě mnohem víc, než jsem si původně myslel.

S.U.P.
dlužíš nám oblíbeného draka. My s Wothanem jsme se vlastně už vyznali (Glaurung a Fáfnir; což je asi v zásadě to samé).
Wothan27.3.2003 (16:12)
Argonaut: vezmi si jak daleko sahala Římská říše a kde tedy byly románské oblasti a sféra vlivu. Jak v Británii tak v Galii máš jak keltský tak římský vliv - tady se sotva dopátráš nějakého závěru. A mimochodem stejné zástavy - tj. drak na tyči jako u Franků bys našel např. v Británii - viz. standarta Wesexu ještě u Hastingu...
elder27.3.2003 (16:43)
Hurá, hurá! Konečne som si toto monštrum dočítal do konca. Trvalo mi to s prestávkami na také banálne veci ako plnenie pracovných povinností a základných fyziologických potrieb len jeden a pol dňa :-). Z vás, chlapi, musia mať vaši zamestnávatelia radosť, čo :-). Čakám kedy začne na mňa zazerať moja šéfka (alebo u vás je to iné?). Ešte si tak prečítať fórum Boh a ďalšie, ktoré sa utešene rozrástly. Hm, ignorovať diskusiu na Pevnosti kvôli práci a potom sa hodiť na týždeň na PN-ku sa moc nevypláca :-). No, ale k téme.

Máte, slovutný drakológovia, povedomie o čisto slovanských (staroslovanských, praslovanských) pomenovaniach pre drakov? Dočítali ste sa niekde, alebo máte nápad, ako by mohli naši predkovia nazývať takéto tvory, bez toho aby si vypomohli latinčinou resp. gréčtinou? Akceptujem aj vlastné výtvory znejúce dostatočne slovansky. Mne sa, okrem takých všedných názvov ako plaz, jašter, had či červ, nepodarilo nájsť ani vymyslieť nič poriadne (upozorňujem že na slovensku často používané "šarkan" má turecký základ). Vopred dík za info.
Argonantus27.3.2003 (18:03)
Elder:
výborná otázka. U nás v "Bohemii" je to jednoduché - nejstarší písemná zpráva je zřejmě ten kanovník Vyšehradský (1130), v originále latinsky, a celoevropský výraz "draco" zřejmě převzala čeština dost záhy (přesný doklad chybí, ale už pověst o Bruncvíkovi, řádově 14. století, s tím nemá problém.)

Kdy byly sepsány byliny, to se zeptej Wothana, nebo toho maníka, co připojil komentář k jednomu ze tří drakologických článků na hlavní stránce. Obávám se, že dost pozdě.
Mimochodem, není tím hledaným slovanským výrazem právě "saň"? Tuším, že to dál na západ nemají...
Slovo šarkan jsem zapomněl, ale je dost rozšířené - přinejmenším Poláci mu rozumí (češi moc ne). I to znamená, že Turci to pojmenovali jinak, což je velice zajímavé (svědčí to o oddělenost turecké ideje draka...)
Fanda27.3.2003 (19:35)
Argonante, teď si trochu uhodil hřebíček na hlavičku - je-li saň vícehlavý drak, jak se mu sakra říká na západ od nás, N.B., když je to erbovní zvíře.

Shakespearovské "Zkrocení zlé ženy" - v originále tuším "Taming of the Shrew" by mělo být "Zkrocení saně", nebo možná dračice. Každopádně bychom tu měli další slovo pro draka, kdyby tedy "shrew" nezmenalo i rejsek - otázka je, nakolik to vadí.

A ti Slovanští draci? - Osobně jsem v tomto ohledu dosti skeptický (sakra, a v jakém ne??) - ruské byliny se dají nakrásně nařknout z Vikingského vlivu a obávám se, že o staroslovanské mytologii se toho ví pramálo (a to co se vědělo, tak s tím zamíchala ještě různá národní obrození). Nicméně ponechávám prostor povolanějším.
Jak vlastně říkají Rusové drakům?
Celé tohle mě mě ale na otázku Ptáka Noha - co ten - je to také velká lítající potvora a nějak nevím, k jakým pronárodům ho přiřadit.

Ještě si dovolím reagovat o tom vlivu "vícehlavosti" na tu Japonskou pověst - je otázka, z jakého je století, ale obávám se, že na evropský vliv se to bude svádět těžko a o vlivu křesťanství, které tam začalo pronikat až někdy v 16. století by šlo s úspěchem polemizovat, nevíc, když ani teď není křesťanství v japonsku nejrozšířenější. Mohli by to samozřejmě přijmout od Číňanů, od kterých ve středověku přejímali kde co, ale nějak mi to na ty Číňany nesedí. Může to být i originální japonský výmsl, ale kamižel o jejich mytologii toho také mnoho nevím.
elder28.3.2003 (7:02)
Argonantus: S tou saňou (saní), máš možno pravdu, aj keď na Slovensku som sa s používaním tohto názvu skoro vôbec nestretol. Dokonca, si pamätám, že keď som ho prvýkrát niekde čítal, nemal som vôbec potuchy o čom je reč (skôr som si to spájal s tým sofistikovaným vynálezom na spúšťanie sa po zasňežených svahoch :-)). Nie je to, náhodou, čisto české pomenovanie? Ale skôr asi nie, čo?
Spomenul som si že poliaci majú na draka aj slovo "smok" (tolkienisti, nepripomína vám to niečo? :-)). Aplikovaním na slovenčinu alebo češtinu mi ale vychádza niečo ako zmok (zmek), čo má však, podľa mňa, bližšie k pomenovaniu nejakého "nižšolevelového" tvora z pekelnej čeliadky (niečo ako imp).

Fanda: Nemám veľa znalostí o ruských bylinách, ale mám pocit, že tam by sme sa tiež najskôr stretli s nejakou odvodeninou od "draco". Vplyv Byzancie na našich veľkých bratov bol predsa len dosť značný. Ešte sa mi marí niečo o šarkanovi v nejakej ruskej rozprávke, ale to je možno len prekladateľský úlet, aj keď, na druhej strane, Osmanská ríša mala s matičkou Rusou tiež nejaké pletky (ostane, s kým vo východnej, južnej a strednej Európe nie, všakže).
Noh sa mi nejak spája s južnou áziou (India?) ale už neviem prečo. Niekde som to tuším čítal. Ale určite má niekto presnejšie informácie.
elder28.3.2003 (8:37)
Tak ma napadá, z akého jazyka vlastne slovo drak pochádza? Je to gréčtina alebo je to niečo staršie? Nemá náhodou pôvod v spoločnom indoeurópskom základnom jazyku? A čo to vlastne v preklade môže znamenať? Vie to niekto? Ako sa po čínsky povie drak? Čo to znamená? Myslím že, ak sa podarí toto rozlúštiť dostaneme sa v pátraní po prvotnom pôvode a prípadnej reálnosti drakov bližšie.
argonantus28.3.2003 (9:12)
Fanda - jako obvykle velmi inspirující:

1) Saň na Západě - suše předpokládám, že není-li na Západě mýtu saně, není třeba slova. Šach!
S heraldickými doklady - nejsem takový machr na cizí heraldiku, abych si byl jist; ale v životě jsem neslyšel o erbovní sani starší renesance (a v renesanci je možné naprosto všechno; zde dovol zmínku o zřejmě šíleném heroldovi Vladislava Jagellonského, který vyráběl věci jako "medvědojelen v barvě přirozené"). Bylo by moc dobře, kdyby se nám tu někdy stavil Divous - třeba ví víc.

2) "Shrew" - opět problém - nejsem takový znalec jazyka. Slovo asi bude hodně staré (Shrewsbury, tolik milované tvůrkyní bratra Cadfaela) - ale netuším, proč by mělo nutně znamenat vícehlavého draka, případně mít vůbec cokoli společného s dračicí, jak předpokládáme my (rejsek v přeneseném smyslu - zlá ženská?)

3) Osobně jsem byl zpočátku otázkou slovanských draků zaskočen - přiznám se, že byliny se mi úplně vykouřily z hlavy (narozdíl od Wothana, Darkelfa a toho maníka z hlavní stránky, co tu tolik absentuje). Ale opět, jako již několikrát, kapituluji před fakty (o spoustě věcí, o kterých tu mluvíme, jsem na počátku této debaty neměl ani tušení!)
Slovanští mnohohlaví a létaví draci prostě jsou; velmi záhadné je jejich stáří; a velmi záhadný je jejich původ - a díky Elderovi je konečně problém i jejich označení (tvoje otázka, jak vlastně říkají Rusové drakům, trvá - já nevím). Všimni si, jak jsme spontánně vychrlili několik zcela novodobých hitů - Křemílek, Bajaja, Devatero pohádek, Z pekla štěstí - a ve všech se suše předpokládá dračí mnohohlavost a létavost...

4) Vikingský vliv v této věci spíše odmítám; Wothan správně upozorňuje, že velmi staří draci Vikingů (asi 9. století, ne-li dříve) se hodně podobají drakům Franků a do jisté míry i Keltů a Římanů. Rozhodně nemají více hlav!

5) Pták Noh - tak teď jsi to vyvedl. To je na dalších 100 příspěvků. Osobně si myslím, že pták Noh je prostě jasný doklad mé téze - někteří pravěcí obří pštrosi, žijící někde v Indickém oceánu, vymřeli někdy v renesanci; právě, když tam dorazili první badatelé. Tohle je fakt; pokud chceš, dohledám podrobnosti. Právě proto předpokládám paralelní děj s drakem, jak o tom byla řeč na počátku fóra, který se ovšem musel udát o dost dříve (v renesanci už živé draky moc nepředpokládám...)

6) Japonsko - nikoli, myslel jsem to přesně obráceně: vícehlavý drak může být klidně myšlenka Japonská, která se k nám dostala do Evropy (logicky do Ruska nejdříve - a tady jsou nasnadě zase ti Mongolové; moje poznámka o tom zcela zapadla... byli v Rusku dost dlouho na to, aby si tu mohli povídat pohádky, které Rusy zaujali... a pak by byl důvod i pro odlišné slovo (ten zatracený šarkan, nebo saň). Ono totiž, podle mne, vícehlavá potvora jasně v Evropě před vpádem Mongolů doložena není (viz tvoje správně pohrdlivá poznámka o slovanském písemnictví - může to být dost nové)

7) Co je kamižel?
argonantus28.3.2003 (9:22)
Elder:
Vždy je skvělé, když přijde někdo nový - zjevně to obohatí pohled. Donedávna jsme všichni automaticky předpokládali, že slovo "drak" je universální minimálně v Evropě (něco takového je patrno z vícero starších glos, i mých). Jistý je ten slovní základ prakticky ve všech jazycích germánů a románů; kromě toho v češtině (ktrerá to jistě přejala - ale fascinující je, znovu připomínám, že v roce 1130 kanovník popisuje neznámý jev odkazem na draka jako na známou skutečnost...), řečtině; keltsky neumím; zajímavé by byli asi pobaltské země... vůbec - nejpestřejší terminologie je zjevně právě na východě (teď už i smok - pravda, jak nevzpomenout "šmoky pravděpodobnosti pana Lema!)

Tvůj dohad, že by to mohlo být indoevropské slovo, se kterým první evropané na scénu už přišli, je nasnadě - ale tím to není méně fascinující (pak by totiž museli být draci i v Indii - tam taky nevím... a připomínám, že Indové jsou velmistři v mnohohlavosti...)

K Nohovi viz můj dnešní vzkaz Fandovi (a potažmo se to vztahuje na Rucha adalší pdobné věci).
argonantus28.3.2003 (9:27)
Elder:

jo a ještě - k celkovému stáří draků připomínám sáhodlouhé 21.3. v 10.09, bod druhý - ve světle této skutečnosti je třeba se na to stáří dívat; je to jeden z nejstarších mýtů vůbec.
Mimochodem - existují draci minimálně z Babylonu, ne-li sumerští...
Wothan28.3.2003 (11:23)
Ad Byliny - přesnou dataci neznám, ale to bude potíž s tím že i tady fungovala staletí ústní tadice a zápis je až velmi pozdní. Jinak vliv germánský - Vikingský (přesněji Švédský) tu bezesporu byl také, ale ani to neřeší vícehlavé saně - odtud obávám se vítr nevane.
elder28.3.2003 (13:52)
Trochu som sa poohliadol po tej etymológii slova drak na nete. Našiel som toto:

---
English-Chinese Online Dictionary http://www.tigernt.com/cgi-bin/cedict.cgi

[chi1] /hornless dragon/
[huo3 long2] /fiery dragon/
[jiao1] /scaly dragon/
[long2] /dragon/imperial/Long (a surname)/
[qiu2] /young dragon with horns/
---

Celkom dosť výrazov, čo? Čo znamenajú tie čísla na konci slov vôbec netuším (výslvnosť?). Myslím, že pre draka najčasťejšie bude slovo "Long". Ale čo z neho vyčítať? Nepoflakuje sa tu niekde nejaký čínsky jazykovedec? :-)

Cez ten istý slovník som sa paradoxne dostal aj k tomuto:

---
dragon
Etymology: Middle English, from Old French, from Latin dracon-, draco serpent, dragon, from Greek drakOn serpent; akin to Old English torht bright, Greek derkesthai to see, look at... tu už nič ďalšie nebolo
---

Vyzerá to, že sme sa dostali akurát k tomu serpentovi - plazovi. Ešte skúsim vykutať niečo z toho "derkesthai". Aj to staroanglické "torth" - bright (jasný, svetlý, žiariaci ale aj vtipný, šikovný, vynaliezavý) vyzerá zujímavo.

V mne dostupných keltských a galských slovníkoch som, bohužiaľ, slovo drak nenašiel. Akurát "dragonfly" = "tarbh-nathrach", kde "nathrach (nathair)" má preklad "serpent, snake, adder". Hm, slepá ulička? Pátram ďalej :-).
argonantus28.3.2003 (14:03)
Elder:
no vidíš - něco tak evidentního, jako hledat ve slovnících, nás zrovna nenapadlo.
O záměnách draků a hadů byla řeč na počátku, a táhne se to celým drakologickým problémem (a nikdo se jistě nediví).

Ale tak mi připadne, že taková ssaň, ssmok, ssnake, sserpenss a snad i ssarkan mají něco sspolečného - jsou takoví plazí...

kdežto drake, draco, draak, drakan, drak, derkesthai jsou takové tvrdé, až krystalovité...

potud k úplné a konečné rehabilitaci Darkelfovy drowí mluvy... v ve zdánlivých pákovinách lze najít nečekaná překvapení
Fanda28.3.2003 (14:04)
Tak mám radost, že se to tu stáčí na debatu ohledně výrazů, na kterou jsem poukazoval už někdy na začátku tohoto fóra ^_^

Pokud jde toho ptáka Noha, tak pochopitelně tu je pštros a dále tu žil nějaký takový pštrosoid na Madagaskaru (jak se to on sakra...) a vyhynul tam celkem nedávno - faktem je, že byl ale Madagaskar osídlen relativně nedávno (kdy netuším) a to nikoli z Afriky, ale od Indie, no a pak různí emuové, nanduové, kasuárové a (také už vyhynulí) moa. Bylo-li něco takového v Indii, nevím. Každopádně nic z toho nelétá - takže i tohoto tvora vznesla do nebes až lidská fantasie, stejně jako tu přerostlou ještěrku, o které je tohle fórum.

Argonante, s tím rejskem můžeš mít přirozeně pravdu - tady by to chtělo opravdu nějakého "anglologa" - nadhodil jsem to jen jako možnost.

Kamižel - to je taková moje japonsko-česká slovní hříčka - "kami" je japonský výraz označující v podstatě božskou bytost (no dobrá, taky vlasy, papír a možná ještě něco jiného) - takže "bohužel" vztažené na Japonsko ^_^

Nicméně ta Eldarova poznámka mě přiměla spustit Japonský slovník a tohle z něj vylezlo po zadání výrazu "dragon" - psáno v čestké traskripci:

DORAGON - evidentně převzaté z angličtiny a pro nás tety nezajímavé
GARJÓ / GARJÚ - ležící drak (ve druhém významu "velkolepý muž" - osoba skrytá za masami)
HIRJÚ - letící drak
KÓRJÓ - drak, který vystoupil na nebesa
KÓRJÓ / KÓRJÚ - dešťový drak (ostatně tato představa není ojedinělá - ačkoli se jinde, tuším u Indiánů, jednalo o okřídleného hada, ale opět může jít jen o rozdílnost pojmenování) - jinak to samé v druhé význmu coby "skrytý génius"
RJÚ - tak toto je samostatný výraz pro draka, tak jak je - je to ostatně vidět na složeninách výše a níže (2. výraz je uveden jako "promoted rook" - ale netuším, jak to rozumě přeložit)
RJÚDŽIN - dračí bůh, dračí král
RJÚÓ - Dračí král (možná též jako král Drak)
TACU - drak, jakožto znamení z čínského zvěrokruhu, taktéž onen papírový čínský drak - je pravděpodobné, že se bude jednat o japonské čtení čínských znaků
WAIVUXÁN - tak tohle mi nazní japonsky ani trochu - v angličtině jako wivern (dvounohý drak)

Doufám, že jste se vzdělali. Každopádně mi z toho vyvstalo další slovíčko - "wivern" - tohle se také tu a tam použije - takže to je co a odkud?
argonantus28.3.2003 (14:38)
Fanda:
Kruhem jsme se mnohokrát vrátili k věcem, které jsme vzali neprávem moc rychle...

1) Noh ještě - no, to létání bych vysvětlil právě tím nedorozuměním, jaké jsem popisoval u velryby a draka na počátku. Když někdo zaslechl o "příšerně velkém ptákovi", pak prostě předpokládal, že pták létá (to dá zdravý rozum - alespoň učenci, který pštrosa a podobné věci v životě neviděl). Okdud a kam se pohybovali zprávy o těchto případech - to už po mně nechtěj; pro naše evropské účely se to obvykle schová pod bezedný pojem "arabští kupci", kteří to docela možná měli od někoho dalšího. Apropo - kdo viděl vycpaného Moa v Národním muzeu, uzná, že je skutečně příšerně velký...

2) Kamižel - nebyl jsem si jist, ale tušení se naplnilo v plné hrůze (na jiném fóru jsem zahlédl "Thoružel" (to jen pro Wothana ke konstrukcím víry).

3) Mají-li Japonci svoje "rjú", ještě s mnoha praktickými složeninami, a číňani "long" a kdovíco ještě (proč se long podobá anglickému "dlouhý"? náhoda?), pak to jen potvrzuje jakousi úžasnou a úpornou mytologickou potřebu draka, která jest asi hlavním tématem a příčinou tohoto fóra...

4) čistě pro tvé pobavení - odkaz http://www.novinky.cz/Index/Styl/697.html
(pokud mi ho někdo zas nesmaže), pro milovníky kryptozoologie... a mimochodem, dá se najít odkaz i na to kongamato
argonantus28.3.2003 (14:41)
Fanda:

jo, zapomínám - vivern, nebo taky wyvern - hráčům Might and magic zase notoricky známá věc;
hnusné jedovaté drakoidní mrchy, jacísi "nižší" draci, kteří by sice mohli být odpálkováni mezi novodobé fantasy výtvory, kdyby tak silně neevokovali ty "jedovaté" a "magické" souvislosti s baziliškem (a zde nemohu, než odkázat na Darkelfův excelentní popis baziliška v Alchymii)
Fanda28.3.2003 (15:46)
Argonantus: Proč v plné hrůze? Jazyk je živá věc, tak proč si s ním někdy nepohrát jen tak - pro zábavu, zváště, když nám to naše mateřština dovoluje.

Jinak jsme zase u toho jako na začátku: všude se nám vyskytuje nějaká velká ještěrka, které se říká různě a i pohled na ni je různý, protože to, že nějaký Gaidžin pojmenoval Rjú jako draka mohlo být jen pro dostatek jiných výrazů. Ale ta potřeba velkých ještěrek je nepopiratelná. A je dobře, že tu je ("... a sili sémě dračí, my to právo měli...").

Ad ten odkaz: Pěkné, leč přesvědčivý přímý důkaz chybí. Škoda, taky bych rád, aby se nám tu proháněl sem-tam nějaký ten dinosaurus, nebo ptakoještěr.
Divous28.3.2003 (16:05)
K tomu nohovi - pták noh alias grif mohl být klidně velkým pštrosem, proč ne, jen mě pak ale mate, že mytologický grif (který figuruje i v heraldice) má 4 končetiny......
Horní jsou orlí a dolní lví, pak je to gryf a nebo je dolní půlka z koně a pak je to hyppogryf.
No nic, tak popřemýšlejte :-)
Fanda28.3.2003 (16:25)
Divous: takhle ten gryf odpovídá +- tomu, co měli Babylóňané...

Jo, proč to tu píši - Argonante, ta podobnost čínského "long" s anglickým bude na 99% náhodná - nedivil bych se, kdyby tohle slovo mělo v čínštině ještě alespoň 10 významů v závislosti na tom, kam dáš přízvuk a co jak protáhneš a různé regiony Číny do toho radši ani nemíchám.
Argonantus28.3.2003 (17:48)
Divous:
fajn, žes zavítal. Kdy máš nejstarší trojhlavou dračí potvoru (spíše cizí, než naši - u nás je to bída...)?
Gryf - další záhada; tady je ale ta montáž dvou potvor zjevnější (nejmopcnější v heraldice je orlice a lev, proč je nespojit...?).

Všichni:
Především jsem zase u svých domácích zdrojů informací.

1) Takže, abych pokračoval v off topic Nohovi, který opět není pro draky úplně nezajímavý:
- Aepyornis maximus - velikost 3 metry, Madagaskar, příbuzný kasuára (leč bez hřebene a velice vysoký, vzhledem pštrosovitý) vymřel zřejmě před 200 roky (!), tedy ještě později, než jsem myslel.
- Dinornis giganteus, čili novozélandsky "moa" - velikost 3,60 metru, Nový Zéland, příbuzný pštrosa a nikoli Aepyornise, opět vymřel asi před 200 roky - nejasné zprávy ještě z počátku 19. století. V obou případech jim dalo smrtelnou ránu zemědělství.
- Emeus crassus, menší a obéznější moa, 1,80 metru, též Nový Zéland, předpokládá se vymření ve 13. až 14. století (a živého ho tedy žádný badatel neviděl).
- Euryapterix elephantopus - opět moa z Nového Zélandu, jen 2,20 metru vysoký, ale děsně tlustý a mohutný, vymřel asi ve 12. století

2) Mnohohlaví draci:
moje mysl pracuje pomalu a skleroticky- reaguje často na věci, které někdo řekl předminule (v tomto případě Wothan o trojhlavém alchymickém drakovi a Darkelf o ptačích hlavách). Teprve dnes mi došlo, že tohle samozřejmě znám - Splendor Solis od Salomona Trismosina, jeden z nejslavnějších a možná nejnádhernější alchymický spis vůbec, který mám doma hned ve třech verzích (rytiny, černobílé foto a reprodukované barevné pohlednice). Pohříchu v textu nejde přenést, na co se právě dívám - srdce milovníka draků by zaplesalo.
Dílko vyšlo 1582 v několika verzích; ta nejproslulejší je překrásný rukopis, chovaný v Berlíně, s 22 obrazy. Nás zajímají zejména obrazy 14 a 15; na tom prvním je ve filosofickém vejci trojhlavý bílý pták, připomínající labut či husu (to jsou ty ptačí hlavy - klidně to můžete vydávat za draka z Devatera pohádek), na tom druhém pak již nepochybně trojhlavý drak, s hlavou červenou, černou a bílou; při tom oba tihle tvorové mají zjevně křídla.
Salomon Trismosin je záhadný až běda; předpokládá se ale, že byl ze Saska; může být o dost starší, než uvedené datum (skoro o sto let); a z různých důvodů si myslím, že působil i v Praze. Nyní rozhodněte, zda mohl mít vliv na Východ i Západ - já myslím, že ty obrazy mohly uvíznout v hlavě lecjakému malíři, a to i v jiné souvislosti (ilustrace Bylin...)

3) Draci Babylonu - jo, máš recht, Fando, vypadaj dost divně, a jsou tak nějak smontovaní... spíš mají něco společného s tím gryfem.
Divous28.3.2003 (18:43)
Co se vícehlavých draků týče, tak ten zdroj inspirace bude starší. Řecká mytologie zná vícehlavé draky-saně, např taková Hydra.
Ale nepodceňujme jiný zdroj inspirace z roku 99 našeho letopočtu - Apokalypsa svatého Jana. Tam má v jedné kapitole vidění vícehlavého draka-monstra také
argonantus29.3.2003 (10:50)
Divous: Touché!
nikoli s tou hydrou - o té jsme už mluvili, a je to hodně divná potvora, která se moc v inspiraci neprojevila... ale se Zjevením svatého Jana, na které jsem úplně zapomněl (zase!) - samozřejmě, tohoto vícehlavého draka museli znát po všem křestanstvu....

Všichni:
Dívám se na problém důkladněji, a provádím výlov Apokalyptický...
1) Celkem je shoda vší vědy, že to Jan vyrobil někdy okolo roku 100 našeho letopočtu (přesněji není moc jisto).
2) Drak se objevuje na scéně v kapitole 12 Zjevení, pokračuje ve 13, a objeví se i v 19. Mám k dispozici ekumenický překlad z r. 1983, kralický překlad, a Melantrichovu bibli z r. 1570, která je předkralickým překladem z latiny - ježto se podivnosti textu projevují shodně ve všech, použiju Melantricha, který je nejstarší a zjevně nejpůvabnější (kapitola 12, těsně za začátkem):
"... a vidín jest jiný div na nebi; a hle, Drak veliký ryšavý, maje hlav sedm a rohuov deset; a na hlavách jeho sedm Korun a Vocasem svým strhl třetí díl hvězd z nebe a svrhl je na zemi. A ten Drak stál před ženou, jenž měla poroditi, aby kdyžby porodila, Syna jejího sežral.
.. a stal se boj veliký na Nebi. Michal a Andělé jeho bojovali s Drakem a Drak bojoval i Andělé jeho; a nepřemohli jsou, aniž jest nalezeno místo jejich více v nebi; i svržen jest ten Drak veliký Had starý, kterýž slove Diabel a Satanáš, kterýž svodí vešken Svět; a svržen jest na zemi; a Andělé jeho s ním svrženi jsou.".

3) Dost. Popřemýšlet lze nad podobností s Ancalagonem černým... a kochat se renesanční češtinou... ale mně šlo hlavně o označení draka, o kterém jsme mluvili, a je na první pohled vidět, že mnohohlavý DRAK sv. Jana je současně HADEM ze stvoření světa; a má svoje pekelné anděly (!), takže všechna ta slova nebyla zdaleka tak pevná, jak bychom očekávali. Reviduji tedy svoji glosu Elderovi - Západ znal mnohohlavého draka, ale přesto na něj nemusel mít speciální slovo; každý věděl, že to je TEN drak (v Kosmovi obrat "zrádný onen had" - každý vzdělanec věděl, o co jde.)

4) Bez zajímavosti není ani ikonografie. Monstrum se sedmi hlavami, deseti rohy a deseti korunami je naprosto nepřehlédnutelné; ostatně, v kapitole 13 následuje šelma, podobná levhartovi, s medvědími tlapami a lvími tlamami, a opět se sedmi hlavami, deseti rohy a deseti korunami, a pak ještě šelma, podobná beránkovi, se dvěma rohy, ale mluvila jako drak.
Co si s tím měli chudáci ilustrátoři počít? Obligátně to řešili sedmihlavým drakem, s hlavami, korunami a rohy nepřehledně nacpanými - výsledek je pozoruhodně ošklivé a nepovedené monstrum, věrná ilustrace Wothanových filipik proti neúctě k realitě. Před šelmou číslo 2 kapitulovali skoro všichni a radši ji vynechali, včetně slovutného Durera (Apocalypsis cum figuris, 1498).
Ne tak můj statečný monogramista z Melantrichovy bible. Prvním obrázkem předvedl boj s drakem na nebi; na druhém všechny tři potvory; pak je tu ještě výtečná nevěstka Babylonská na šelmě; drak vržený do plamenného moře (které milosrdně skrývá zmatečný počet hlav); a ještě anděl, který klíčem zamyká draka v tom jezeře (kouká z něj už jen jedna hlava, uff...)

5) Závěry z tohoto výletu jsou rozporné.... svatý Jan, velmistr všech kouzelníků i theologů, se nám jako drakolog moc nevyznamenal. Jeho monstra jsou zjevně alegorická, sledují jeho záhadné symbolické (a také i politické, bohužel) linie, na první pohled je jasné, že tohle nikdy nežilo a žít nemělo... a málem se to nedá ani nakreslit. Ano, kdekdo to znal... ale myslím, že si s tím nikdo moc nevěděl rady. Souvislost se "skutečnými" draky, nevím jak to říci lépe, je dost volná... snad ti Rusové...

Another cup of tea:
Pohled na vyobrazení Zlatého žaltáře (polovina 9. století), který mi vhodně připomněl Wothan (jde o tu franskou korouhev - drak, nesený v čele vojska na tyči, ovšem nevlaje, nýbrž tak říkajíc trčí; je asi vycpaný s nějakou vnitřní páteří, aby byl lehký), mne vede ke zvláštním asociacím. Smysl tohoto draka nemůže být heraldický; spíše jde o to, vyvolat psychologický náznak, že drak letí nad vojskem (nelze nevzpomenout na naši bitvu u Chlumce 1125!); je tam z úplně stejného důvodu, z jakého kreslili letci v druhé světové na letadla žraloky... a jeví tím značnou příbuznost s "lodními" draky Vikingů, kteří mají stejný zastrašovací účel...

Takže POZOR - důležité!!

1) Drak Franků i Vikingů se mi zdá být nápadně pohanský... s tím biblickým (shora) nemá lautr nic společného... a je-li drak pohanský, pak se nám celá kulturní mytologická teorie otřásá v základech (co věděli staří Germáni/Keltové o antice...?)
2) Drakem lze vyhrožovat, má-li reálný základ; není důvodné si dát v čelo vojska Janovo šílené monstrum; je ale důvodné si dát reálnou potovru, jako medvěda, lva, krokodýla, nebo...
Divous31.3.2003 (9:27)
ARGO no, já si spíše myslím, že na ostrově Patmos rostly zajímavé houbičky :-)
Wothan31.3.2003 (10:06)
Ta citace ze Zjevení Janova - 12:

"A ukázalo se veliké znamení na nebi: žena oděná sluncem s měsícem pod nohama a s korunou dvanácti hvězd kolem hlavy. Ta žena byla těhotná a křičela v bolestech, neboť přišla její hodina. Tu se ukázalo na nebi jiné znamení: veliký ohnivý drak s deseti rohy a sedmi hlavami a na každé hlavě měl královskou korunu. Ocasem smetl třetinu hvězd z nebe a svrhl je na zem."

Tenhle drak má 7 hlav a 10 rohů...to mi nějak neštymuje, ale třeba je měl na zádech jako stegosaurus štíty :-) Ale jak pravil Argonaut - tohle je věžný malířský rébus a obávám se že je prakticky neřešitelný.
argonantus31.3.2003 (10:22)
Divous:
takhle jednoduše bych to neviděl - mám sice výhrady keZjevení (viz Bůh), ale na druhé straně Jana dost ctím za evangelium... to rozhodně nebyl žádný magor...

Wothan:
zřejmě cituješ te ekumeňák. Právě, že na některých hlavách jsou dva rohy, a na některých jedna (a kroruny jsou navlečeny na rozích, takže někdy i dvě na hlavě...) - nikdo jiný to nevyřešil líp. Prostě prasárna. Vůbec se nedivím, že mnohohlaví draci nepřirostli lidem k srdci...

oba:
za mnohem podstatnější považuji konec své sáhodlouhé glosy, který se váže k té franské standartě...
Wothan31.3.2003 (10:48)
Argonaut: jinou citaci bohužel nemám, ale tam nikde není napsáno že má rohy na hlavě - to že se to u pekelného stvoření bere tak nějak samosebou mi samosebou vůbec nepřipadá, tobě ano?
darkelf31.3.2003 (10:58)
Taky něco, co jssem našel doma v Besstiářích (opět bohužel v Humánštině):

Wyvern: (něco málo z humánsských textů)
- (heraldický drak Walesu, ale to sspíš pro Divouse). Původní Wyvern měl pouze zadní nohy a místo předních končetin blanitá křídla. Bývá považován jako ženský protějšek draků (něco jako vrána a havran)
- Jinak jsou to vzdálení příbuzní draků, velcí létající ještěři s jedovatým žihadlem na ocase. Jsou 30 stop dlouzí, šedé až tmavohnědé barvy, jenom špička ocasu je holá a podobá se škorpionímu. Kožená křídla mají rozpětí přes 50 stop. Obří čelisti jsou vyplněny dlouhými ostrými zuby, oči jsou rudé nebo oranžové. Oproti drakům mají jen zadní nohy, které používají při lovu jako dravci.
W.jsou sice hloupí, ale zato vždy agresivní. Útočí na všechno, co není zjevně o mnoho silnější. Snese se z výšin, popadne oběť a žihadlem usmrtí. Spáry může útočit jen při útoku z letu, přitom ale nemůže použít žádný jiný útok současně.

Hydra: (ač tu byla zmíněná jakožto ssaň) četl jssem, že tento tvor může mít ssouvisslosst ss krakaticemi (ta voda a
d.) a proto považuji za Ssaně nelétající draky ss jednou hlavou. Vícehlavosst dračí sse mi prosstě příčí.

Další tvorové, co mají co ss draky do činění:

- Tiamat: Babylonská Hadí Matka Bohů
- Nágové: Tajemný indický hadí národ
- Mo-o: polynézky drak kradoucí ústřice
- Gargouillové: podivní malí kamení draci
argonantus31.3.2003 (12:33)
Wothan:
no, všem mým ilustrátorům (včetně jednoho ze 14. století) to samozřejmé připadalo. Jinak ty rohy (ostny), o kterých jsme již mluvili na Elfech, jsou zase samostatný problém... ten bych teď ještě odložil (dračí hřeben)

Ale co ty na moji teorii zastrašování 29.3. dole, a zejména nápad, že draci jsou vlastně pohanští? Není to dost velká díra do našich přejímacích mytologických teorií?
argonantus31.3.2003 (12:39)
Darkelf:

jen glosy - wywern je waleské slovo, nebo jak..? kde jsi to vzal?

- hydra - mám dojem, že se nám zadními vrátky vrací chobotnice, beholder a Cthulhu... jinak nápad na souvisost hydry a krakatice je geniální. Kdo na to přišel?

- k nelibosti nad vícehlavými draky jsme se hlásili skoro všichni. Zvláště, když jejich pravzor je Janův paskvil... a hydra možná drak vůbec není...

- Tiamat je třetí sefira, prázdno, vlastně gravitace. Alespoň jak jsem pochopil původní prameny (Gilgameš). To bych sem netahal.

- Nágové: nágy znám taky; opět poukazuji na podivnou zálibu Indů (a potažmo Slovanů) mnohohlavosti... další počátek nápadu na saň?

- Mo-o: o tom vím houby

- Gargoyl: kamenný chrlič; zjevně novodobé zpracování středověkého artefaktu; s draky opět souvisí jen volně )drak - chlič, sekundárně zpracovaný v potvoru)
Divous31.3.2003 (12:41)
prostě pět hlav mělo dva rohy a dvě hlavy žádný, a nebo čtyři hlavy roh jeden a tři hlavy rohy dva...jasné jak facka
darkelf31.3.2003 (12:49)
Argoantus: Četl jssem to v jednom besstiáři! Ani nevím, čí je to myšlenka, ale docela mě zarazila, že mě to nenapadlo dřív (kterépak zvíře má hodně hlav)
darkelf31.3.2003 (12:50)
Divous: Nemohl by jssi sse kouknout na toho Wyverna vs. Wales (v rovině heraldiky)?
darkelf31.3.2003 (13:04)
V anglickém jazyce mají taky dva druhy draků:
a) dragon (okřídlený)
b) Drake (bez křídel)
argonantus31.3.2003 (13:20)
Darkelf:
dragon versus drake - zadej bližší informace - odkdy to tak má být... například dichotomiemezi saní a drakem, která se nám jevila být s Divousem na počátku jasná, je teď čím dál tím nejasnější

jinak i tobě můj odkaz na 29.3. na konci - považuji tuhle myšlenku za dost zásadní; pokud najdeme draky na víc místech, kde o sobě nevěděli, budou mít dokazovači jejich neexistence docela problém...
Wothan31.3.2003 (13:37)
Dark: úctyhodné...to muselo dát dost práce se slovníkem ne? :-) Je hezké jak jsi tam vpašoval svůj jazyk :-)
darkelf31.3.2003 (13:38)
Wothan: Když víš co hledat a kde, tak najdeš věcí!!!

Jinak další associace: Drak vs. Kometa
Fanda31.3.2003 (13:55)
Darklef: Ta jugoslábská Zmaj mi někaj evokuje zmiji (jednovatého hada)...

Jinak mě napadlo k těm japoncům, že to, že převzali anglický název pro draka by mohlo značit, že cítí jistý rozdíl mezi drakem, tak, jak je znám v Evropě, a svým ryuu.
argonantus31.3.2003 (15:07)

velkolepý výlov jazykovědný... potvrzuje naše laické tvrzení, že slovo drak (nebo takový nějaký základ) je rozšířené přímo zběsile

odchylky rostou se vzdáleností (což asi nikoho nepřekvapuje) a se stářím jazyků (Aljaška ?, Havaj ? - čertví, kdy a odkud to slovo mohl někdo dovézt)
skutečně divné jsou ty odchylky ve východní Evropě (zmaj je ta druhá, hadovitá parta slov - ssnake, ssmok, vššak víte...)

ale ještě jednou se dovolávám - což, jestli znali Keltové a Germáni (u těch to tak vypadá) draka před příchodem křesťanství (čehož se lze nadít?) Kde se to potom u nich vzalo?
Wothan31.3.2003 (15:39)
Argonautus: myslím Germáni že znali - ta zmíněná pověst o Sigurdovi je sice zapsána až později, ale je mnohem starší a bez draka by postrádala smysl.
Divous1.4.2003 (7:23)
no, ten popis wyverna docela sedí na heraldického draka, zajímavý je ten jedovatý osten na konci ocasu, ten má heraldický drak taky
argonantus1.4.2003 (9:06)
Divous:
tohle jsem si taky nikdy neuvědomil...
jinak - heraldického draka znám z různých teoretických knížek (Schwarzenberga, Zengera, Bubna, snad je i v Královi z Dobré Vody) - ale všechno jsou to vlastně dost moderní prameny... a když se pak člověk zahledí pečlivě na opravdové staré draky, shledá často něco dost jiného (to Vysoké Mýto - už jsem viděl i další verzi ze14. století - na obou je drak spíše anatomický, než heraldický; nemá žádný jedovatý šíp, žádný oheň...)
ostatně, dokladem jsou i tebou uvádění Kunvaldové (Vraždové a Dražičtí) - jednak je to, tuším, 15. století; jednak se v popisemch neustále plete drak a bazilišek...

Wothan:
1) Naši mytologičtí draci nechrlí oheň zruba do roku 1200 - není -liž pravda?
2) Zdrcující většina jich nemá více hlav (výjimky jsou jasně vymezené - drak Janův)
3) Naši mytologičtí draci jsou zřejmě starší, než křesťanství, a tudíž i písmo (Fáfnir, ale s něčím hrozně dávno zápasil i Thor, ne? Merlinovi draci pod Vortigernovou věží; a hlavně - někde najdu ten obrázek keltské duhovky s drakem...)
4) Draci jsou užívání jako symbol síly, nebezpečí; v boji posilují vlastní jednotky a zastrašují nepřátele (trochu jako drápy a zuby na krku)

a teď už si nejsem tak jist:
5) Draci jsou reálnější a samozřejmější na severu Evropy, než na jihu
6) Pokud je to všechno tak, museli si je vymyslet někde na severu Evropy nezávisle na dracích východu... a nebo...
Divous1.4.2003 (9:20)
ARGO o časté záměně drak-bazilišek jsem psal také v tom článku o dacích na erbech.
Osobně to rozlišuji tak, že heraldický drak má mít dvě nohy a hadí tělo, bazilišek taktéž ale hlavu kohouta a saň má tělo ještěra a nohy čtyři. Samozřejmě to ale 100% neplatí, zmatek je v heraldice dosti velký co se těchto potvor týče.
Zrovna ale to Vysoké Mýto mělo na původní pečeti draka dvounohého. Proto jsem i na svém ilustraci současného znaku Vysokého Mýta nakreslil dvounohého draka s hadím tělem, i když město dnes užívá draka čtyřnohého. Toto přidání noh nepovažuji v případě vsokého Mýta za akceptovatelné, když existuje dochovaný doklad o "dvounohosti" !
Pro změnu ale u Trutnova jsem nechal "ještěrku", protože i dochované pečeti měli čtyřnohou saň (i když v popisu znaku se dočtete, že sejedná o draka :-))
Wothan1.4.2003 (9:35)
Argonaut: bůh Thor bojoval s Midgardsormrem - toho popisují mýta spíš jako mořského hada obepínajícího zemi lidí. Thor s ním zápasil celkem dvakrát - jednou jej ulovil na býčí hlavu, ale netvor mu unikl. Podruhé se s ním setkal (nebo setká? :-) ) v Poslední den - v den Ragnaröku a zabil ho, ale sám podlehl Midgardsormrově jedu, neboť jak praví

54. strofa Voluspa (Vědmina píseň):

Tu proti netvoru
přichází slavný
Hlódynin syn
bít ses hadem.
Podlehne sani
plné zloby
mocný ochránce
celého Midgardu
- mužové domovy
opustit musí -
devět kroků stěží
drakovi uhnul Fjörgynin syn,
bez hany vládce.

Je zajímavé že i když se běžně mluví o Midgardsrormrovi jako o hadu či netvoru, v Hegerově překladu je použit pojem "drak". Hegera bych z neznalosti nepodezříval ani náhodou, takže je to asi zase otázka výkladu pojmu. Podívám se jak to znělo v originále.
Wothan1.4.2003 (9:37)
Ostatně v témže překladu jen na 48. strofě se jasně mluví o Hadu...asi to skutečně nerozlišovali.

Moje nejoblíbenější strofa je ale 55-tá:

Slunce se tmí,
v moři zem tone,
do hlubin padají
hořící hvězdy,
plameny celý svět
pohlcují,
sahá žár ohně
k samému nebi.
argonantus1.4.2003 (9:50)
Divous:
k dvounohým - čtyřnohým drakům připomínám svoje dávné 27.2. v 9.31 - považuji z růných dobrých důvodů dvounohou verzi za logičtější a původně starší, i když v současné fantasy pohříchu čtyřnozí draci vítězí na celé čáře...

To Vysoké Mýto mi hraje do noty; a Wothanem připomenutá korouhev taky (Wothane - fakt nevlaje; trčí)
argonantus1.4.2003 (9:58)
Wothan:
nejistota ohledně rozdílu mezi drakem a hadem tu už byla mnohokrát... například u toho Jana (kde je monstrum navíc vícehlavé)...

Kruhem se vracím k jedné z prvních otázek, kterou jsme tu už řešili - odkdy draci létají? Automaticky jsem považoval létání draka za jeho podstatný znak; bez něj se totiž stane hadem (narozdíl od počtu nohou, ohně, názorů na poezii, bez kterých se drak nakonec obejde).
V mé dost staré (a bohužel pozdě zapsané severské mytologii) draci létají ve většině případů...
Wothan1.4.2003 (10:30)
Argonaut: to nic neznamená - to může být stylizace - prapory a korouhve se v tomhle období taky nezobrazují plastické a vlající, ale trčící, rozvinuté jako bys je naškrobil :-) Myslím, že plastická byla jen přední část draka - musela kvůli usazení na žerď, ale tělo asi ne - navíc by bylo mnohem působivější ji nechat vlát - tak se to také obvykle vykládá v rekonstrukcích z původního vyobrazení - něco ti pošlu. Ono kdyby to bylo pevné tak by to asi bylo poněkud nevyvážené, pro jezdce co to má na žerdi nesmírně nepříjemné k manipulaci (páka ocasu v poměru k hlavě) apod. Skutečně pevná byla jen původní signa militaria římanů (pochopitelně vexillum ne) - takže ten drak (draconarium - jedna z variant signa kohorty) byl nepoměrně menší - asi ve velikosti jaké měl manus, nejspíš také menší než aquila.
argonantus1.4.2003 (10:44)
Wothan:
mne jen zaujalo, že ten drak ve Zlatém žaltáři je upevněn někde ve třetině délky, ne-li v polovině - tak jakápak páka... a jak, medle, by mohla být ta část těla jen textilní, když tam je to upevnění?

to je ale problém soudobého konstruktéra living history - mne spíš zajímá ten psychologický moment, že drak má vzbuzovat asociaci reality... přinejmenším podprahově a magicky

k současné evergreenové otázce - létají tihle draci na korouhvích? křídla musí mít dost zakrslá, už z těch konstrukčních důvodů.. ale mají je vůbec?
Divous1.4.2003 (11:03)
ARGO naprostý souhlas. Drak tolik rozšířený ve fantasy-žánru (a jehož vzhled považuji za asijského hybrida, viz můj článek v Pevnosti) , který má 4 nohy a ještě navíc jeden pár křídel, tedy tvor se 3 páry končetin je naprostý biologický nesmysl. Vždy by to měl být 4-nožec a přední pár končetin je buď párem končetin nebo je přeměněný v blanitá křídla - viz draci ve filmu Reign of fire, kteří se mi velmi líbily.
Čili i heraldická saň by měla být kreslena bez křídel, i když většinou není
Divous1.4.2003 (11:05)
ukažte mi v přírodě živočicha vyššího řádu (od obojživelníků výše) který má 4 páry končetin a ještě křídla
elder1.4.2003 (11:13)
darkelf - k tomu zoznamu:
Padám na zadok! Prezraď, odkiaľ si to všetko vyhrabal?
Ten srbský a juhoslovanský (aj slovenský? Nikdy som sa s tým nestretol) zmaj sa mi celkom pozdáva aj keď to zrejme bude tá zmija ako písal Fanda.
Dosť z tých názvov by si zaslúžili podrobnejší etymologický rozbor. Ak si nájdem čas na zopár sa pozriem. V tej gréčtine mi chýba ten derkesthai. Dnes si asi pôjdem kúpiť grécky slovník (na nete som nič poriadne nenašiel) a uvidím čo vypátram.
Wothan1.4.2003 (11:20)
Argobaut: těch vyobrazení je mnohem víc. Já mám představu (a podotýkám že je to jen odhad, spekulace - pravdu se už dneska asi těžko dozvíme) a už jsem to i psal - že hlava a hruď draka bude plastická - tj. nejspíš ze dřeva. Ta je taky upevněna na té žerdi. Část těla a ocas je ale podle mne textilní a vlaje ve větru.
Fanda1.4.2003 (12:00)
Divous:
Tak o tomhle jsem psal už někdy na začátku diskuze - mezi suchozemskými obratlovci vskutku nenajdeš živočicha, který by měl 6 párů končetin - občas se sice takového narodí, ale hned to umře, tudíž se dá tato mutace pokládat za letální a není se co divit, že se nic takového nevyvinulo. No, popravdě, tahle "čtvernohost" je vlastně i u ryb a paryb.
A pokud jde o hmyzí křídla (píši jen tak pro zajímavost), tak to je vlastně horní část (exopod) kráčivé končetiny, jen je to zanořené do těla a tak to dělá dojem "dvou nezávislých výrpstků na jednom článku" - jen podotýkám, že hmyz má kráčivých nohou 3 páry, přičemž křídla jsou na 2. a 3. (to abych předešel některým nedorozuměním).

Pokud jde o tu lítavost, tak mám takový pocit, že Východní draci něco takového jako křídla vůbec nepotřebují (také se vám zdá, že ti šikmoocí ďáblící mají nějakou větší fantasii - my Evropané, když chceme něco rozlítat, tak tomu musíme montovat křídla...)

A ad ta vícehlavost - jako se narodí tu a tam něco s více končetinami, narodí se občas i něco s více hlavami (sám jsem viděl dvouhlavé, šestinohé tele - zemřelo krátce po porodu, pochopitelně) - jenže u hadů se občas narodí dvouhlavý jedinec, který JE životaschopný! Že jsem si na to nevzpomněl dřív!
argonantus1.4.2003 (12:05)
Wothan:
nepřu se - máš určitě víc podkladů. Můj dojem vycházel z jediného obrázku (jen pro úplnost - a o když to dělali různé národy různě...?)

šlo mi o ten psychologický moment věrohodnosti draka, který je u té korouhve důležitý (a související s loděmi vikingů a se řraloky na letadlech druhé světové...)

Divous:
docela by nám pomohl nějaký hodně starý štambuch, třeba francouzský nebo anglický... já jsem nikdy nic takového nestudoval... nevíš o něčem podobném na netu?

Elder:
objednal jsem u švagrové dotaz stran toho indického původu slova drak... uvidíme, co to udělá
- jinak - co říkáš problému wyverna? na mně to dělá dojem čehosi keltského - ale jsem laik

Všichni:
na svoji důležitou otázku - odkdy draci létají - odpovídám sám, že minimálně od roku 1130, kdy létal s naprostou samozřejmostí ten kanovníkův drak...
argonantus1.4.2003 (12:20)
Fanda:
máš razítko s dráčkem za ty dvouhlavé hady - myslel jsem na ně celou dobu, ale narozdíl od tebe jsem nebyl schopen říci, čím jsou zajímaví a důležití... tohle je samozřejmě možný zdroj mytologických úvah o vícehlavosti - mohli si toho všimnout už hodně dávno (a nepovažuji za náhodu, že z našich výlovů vylezli vícehlaví hadi o hodně dříve, než draci- viz ta hydra - povšimni si ovšem ještě Darkelfova objevu s krakaticí)

jinak - myšlenka létání východních draků je pro mne strašlivá záhada... přijmu-li jako jeden z velmi mocných zdrojů mýtu opět toho Darkelfova východního maníka nad kostrou (přesněji páteří) velkého sauropoda, pak mi prozraď, jako kovaný otaku,
PROČ KSAKRU TOHLE MONSTRUM MĚLO JEŠtĚ KE VŠEMU LÍTAT!
argonantus1.4.2003 (12:31)
Fanda:

off topic - neodpustím si k té východní fantazii - my ze Západu sice nemáme tolik fantazie, ale máme různé wothanovské koumáky, kteří si dají záležet, aby to fakt fungovalo.
Proto se Východ povznesl ke kung-fu a podobným vznešeným věcem, kdežto pokleslý a primitivní Západ napřed zapancéřoval maníky do kovu a dal jim meče, a nakonec to skončilo u tomahawku, naváděného z družice...

náš primitivní západní drak potřebuje k lítání křídla, ale já nevylučuji možnost, že fakt lítal...
Divous1.4.2003 (12:34)
von možná křídla neměl ani ten původní Evropský ale protože prostý člověk z přírody věděl, že bez křídel nemůže nic létat, sám mu je přisoudil
argonantus1.4.2003 (12:57)
Divous:
tohle právě je kardinální otázka; stojí na ní provokativní myšlenka, kterou jsem tohle celé vlastně rozpoutal (26.2. ráno + glosa večer 25.2.), veden k tomu dnes již legendární tázkou jistého Anonyma.

Jsou v zásadě možné dvě verze:
A) - draci vznikli v mytologii krotkou evolucí z hadů (řádně mytologicky zvětšných) - tak nějak by si to přála oficiální věda

B) - draci byli létaví od počátku; neb to je přeživší pterosaurus, který se motal lidskými dějinami pohanské Evropy v pustých severních oblastech (a možná na pobřežích) k určitému zděšení svých současníků, ne nepodobni těm Nohům o pár glos doleji; a potom se z dějin tiše vytratili - (nejpravděpodobněji s rozvojem zemědělství ve středověku). Tak bych to viděl já.
A uznávám, že konečný důkaz nemám. Jen mi to připadá být nejelegantnější vysvětlení minimálně celoevropské (a ne-li celosvětové) dračí mánie (a také podivné biologické smysluplnosti základní ideje draka, která u většiny jiných mytologických nestvůr absentuje).
Darkelf1.4.2003 (14:01)
Elder: nejen sstarší mají zdroje. Jssem na ssíti.....WE ARE BORGS
Darkelf1.4.2003 (14:04)
Šesst nohou, proč ne?! Kde berete tu jisstotu, proboha.
argonantus1.4.2003 (14:44)
Darkelf:
naše jistota plyne z empirie a z technického poznání evoluce. Já bych na to vsadil. Byl-li drak, pak byl dvojnohý. Nebyl-li, pak je to jedno.

Jinak radím odbočit - už se zase řítíme k obhajobě pravděpodobné reality proti nepravděpodobné, a už to začíná být trochu profláknuté...
Darkelf1.4.2003 (14:50)
Argonantus: Dobře, já do toho mluvit nebudu. Mí draci mají šesst noh, vy ssi běhejte za Wyverny "-(
Wothan1.4.2003 (14:51)
Když může mít kůň 8 :-))
argonantus1.4.2003 (15:15)
Všem:

dál hledám hodně staré lítací draky... WANTED!
Wothan1.4.2003 (15:26)
Škoda že jsem ho vyhodil...byl oprvadu starý :-) Jak stará je vlastně tradice pouštění draků? :-))
Fanda1.4.2003 (15:30)
Argonantus: Popravdě řečeno opravdu nevím (i přes veškerou snahu stále zcela jako Asiat nemyslím ^_^), jak přišli na to létání bez křídel, ale asi to bude tím, že v Asii dokáže lítat cokoli, co je dostatečně mocné, cokoli, co se dokáže "povznést" nad normální svět - bájnými mistry bojových umění počínaje a draky a bohy konče.
Krakatice - nevím, ale krakatice je dosti hlubiiný tvor a takovou hloubku ve Středozemním moři nemáme (+- 1 km), ovšem moře mohlo vrvhnout cokoli. Pak by muselo dojít k záměně hlav za chapadla....
Tvůj sen o pterosaurovi může být pravdivý (a lochneska by zase mohla být plesiosaurus - HA, další "drakoid") - fosilní záznam je dosti děravý a třeba chudinku latimérii nenašli celé třetihory - nezbývá než čekat, ale kdyby se něco našlo, snad by to mohlo mnohé vysvětlit, kdo ví - zatím zbývají jen ti hadi.

Divous: to znamená, že prostý člověk středověké Evropy byl tupější než prostý člověk z Číny ^_^

Darkelf: Chceš-li se dočíst, proč ne 6, odkazuji na některý z mých ranných přízpěvků. Neznámé výrazy pochopitelně na požádání vyssvětlím ~_^
Samozřejmě to ale není důvod k tomu, aby ti Tvoji draci 6 končetin neměli.
argonantus1.4.2003 (15:32)
Wothan:
vypadá to nějak čínsky... i když představa kanovníka Vyšehradského, který si vyrábí draky a pouští je nad Vyšehradem, je taky pěkná (bylo by mu to podobné).
jinak - proč říkáme tomuhle drakovi z papíru drak, když třeba pro angličany je to kite?
Wothan1.4.2003 (15:44)
Argonaut: hmm, aha, odtud východní vítr zdá se vane. Jinak v češtině je drak i kostra - konstrukce. Ale to asi bude důsledek těch papírových.
argonantus1.4.2003 (15:49)
Fanda:
tohle je dost dobré, co říkáš; východní mudrc dumal nad létáním jako takovým; takže vymyslel levitaci; západní technokrat koumal nad křídly (takže dospěl k letadlu, ale ještě mu to dost trvalo). To bych asi bral.

pak je tu ještě třetí verze s těmi opeřenými hady z Ameriky - ale přiznám se, že na to nemám.

Pokud někdo zmiňoval draky v Indonésii, tam jsou varani a krokodýli... draci by tam byli zajímaví opět pouze v případě, že létají.

Jinak - Fando, poraď - co je pro draka lepší biotop - les, pobřeží, nebo bažiny? V Evropě máme k dispozici lecos...
Fanda1.4.2003 (17:46)
Argonantus:
OK, vezměmež tedy takového draka evropského (Draco europaneus), evolučně vzniklého - možná tedy něco jako ptakoještěra, masožravého, anžto je to veliké a lítá to (a o býložravém drakovi jsem neslyšel)
Je to velké a má to velká křídla, takže aktivní let u toho nepřipadá v úvahu - bylo by to moc namáhavé. Takže to musí využívat termiky a stoupavých vzdušných proudů, aby se to vzneslo - takže hory, potažmo velehory, aby tam bylo dostatek možností k hnízdění (jeskyně a tak). Zde by mohl lovit kamzíky, horolezce a snad i orly, popř. by se mohl pouštět i dál - vlastně nemohlo - muselo by to lovit na otevřené krajině (horské louky, ovšem sekundárně také pole) - pochybuji, že by to jen tak vlítlo do lesů a riskovalo to poranění křídel a hlavně by se to pak špatně vznášelo. Svou kořist by musel chytat v letu, popř. by ji mohl napřed usmrtit vyplivnutím toho jedu (ale nemyslím si, že by ho ke své velikosti potřeboval) a pak sebrat (opět v letu) mršinu. V době říje by muselo být úchvatné sledovat zápasící samce, jak ve vzdušné akrobacii do sebe tlučou kyjovitými konci svých ocasů (to ten "štírovitý ocas") ve snaze srazit svého soka na zem.
Předpokládáný výskyt: Alpy, Karpaty, Pyreneje. Možná by mohl na zimu migrovat do zimovišť na Atlasu.

Pochpopitelně by byl možný i o něco subtilnější příbuzný (Draco europaneus ssp. britanicus), který by sídlil nad skalními útesy u moře a využíval stoupavých vzdušných proudů při pobřeží. Měl by užší křídla a tlamu a mohl by lovit třebas delfíny. Jestli by byla konstrukčně možná varianta ala albatros využívající větrného proudu nad vlnami, si netroufám říci.

Toto ale vztahuje jen na draky okřídlené - by-li li by neokřídlení, tak teoreticky kdekoli, jen je otázka, jak a co by lovili - při jejich velikosti mi štvaní nepřijde jako dobrá strategie (a jakmile by potkali les, byli by v koncích) - pravděpodobně by se jednalo o číhajícího lovce - takže pak klidně ty slatiny, popř. vodní plochy - když to tak po sobě čtu, je to krokodýl.
argonantus1.4.2003 (19:49)

Darkelf:
na tvé výslovné přání pár poznámek o sv. Jiřím.
Ve středověku jeden z nejslavnějších světců. Měl prý žít někdy ve 3. nebo 4. století coby rytíř z Kappadocie, který zachránil v Libyi (!) v místě Silene nějakou dívku před drakem a obrátil tak na víru tisíce lidí. Pak působil v Palestině, kde po mnoha divech, jež mu připisuje středověká tradice (Legenda Aurea hlavně) byl v Nikomédii mučen a nakonec popraven z vůle Diokleciána. Historka s drakem je neslavnější část (pozdní, katalánskou verzi má ještě můj Montse Saint); a také nejčastěji zobrazována. Využitím dračího kouzla (totiž - přitažlivosti draka, o níž nikdo z nás diskutujících nemůže rozumně pochybovat) se Jiří stal výjimečný tím, že je světec oblíbený na Západě (patron Anglie, slavný už před příchodem Normanů) i Východě, ač není apoštolem nebo něco podobného. O jeho podivné úloze u nás viz můj článek, který snad vyjde v Pevnosti. Ikonograficky je prakticky vždy zachycena ta drakobijná scéna; a Jiří skoro vždy bodá draka do tlamy (viz Wothanburg.cz)
V tomto wothanburském článku je ještě další zajímavá dračí svatá - Markéta Antiochijská, která si odmítla vzít pohana (obvyklé klišé), ale za to byla předhozena a nakonec sežrána drakem (!).
Třetí dračí svatý je archanděl Michael - ten je ale přehledný jako Nuselský most; vše o něm bylo řečeno v pasáži o Janovi a Zjevení.
Za zmínku stojí ještě pařížský biskup Marcel, který prý zahnal draka berlou, a je vyobrazen v Notre Dame.
Vrátím-li se k Jiřímu, což je asi nejslavnější verze archetypu I, pak v tom bývá viděna velmi často církev, přemáhající pohanství (téma u ranných křestanů neobyčejně aktuální a atraktivní); takže vidění Darkelfovo draka coby "veliké ssíly, jenž tresstá" - i když bez té přírody - není tak úplně od věci... a přijde mi dokonce ještě starší a hlubší vrstvou, než ten Satanáš.

Konečně zbývá zmínit můj další experiment, jehož cílem bylo zjistit, zda má křídla drak na nebesích. Odpověd je zase dvojznačná:
1) V naší, dnešní (řecké) verzi drak křídla nemá
2) jenže postavení nanicovatého souhvězdí Cephea, které mohlo být klidně dříve součástí Draka, by mu zase křídla dávalo...
argonantus2.4.2003 (10:15)
Fanda:
Tak, teď jsi učinil další věc, kterou jsme asi měli udělat už dávno. Mate mne, že naše mytologické zprávy tak nějak nekorespondují s tím, co jsi řekl... a nebo jim spíš špatně rozumím.

1) Latinský název draka - mně se líbí; poznamenávám jen, že Montse Saint se tudy už vydal, a dopadlo to jinak; vytvořil Velkého draka pozemního (draco rex crispus, tuším), draka vodního (draco splendens), a draka ohnivého (zapomněl jsem jméno) a jeho dva poddruhy.

2) Aktivní let; a jsme zase u toho; teď už jsem ale chytřejší, a vím, že jsme v zajetí moderního mýtu dinosaurů. Proč jinak by se v Montse Saintovi objevila věta, že "drak je homoiotermní plaz"?
Dřív se na to kašlalo, a mne teď napadá důležitá věc - při velikosti draka lze důvodně předpokládat, že drak lítá jediným pro tuto velikost ověřeným způsobem - nemává křídly skoro vůbec, jako větroň (stejně jako orel nebo albatros); problém aktivního letu se může soustředit maximálně na otázku startu a nabrání výšky (buď se spouští ze skaliska jako rogalo, nebo přece jen párkrát mávne). To lze nesnadno rozhodnout; připadne mi, že homoiothermie by drakovi přinesla víc starostí, než užitku (ohromné srdce, spotřeba potravy atd. - vše se to nekonečně řeší u těch dinosaurů). Navíc dnes už tušíme některé přechodné možnosti, které se nám moc nedochovaly.

3) Homoiothermie - kterou bych připustil maximálně nějak neúplnou - má vliv na mnohem důležitější věc, než způsob letu - na drakovo rozšíření. Myslím, že můžeme s klidem odmítnout draky za polárním kruhem (s plazy to na severu za moc nestojí, a je jasné, proč). Problém - proč je tedy drak tak hrozně oblíbený v Norsku? Jde jen o jižní polovinu země (kde to trochu zachraňuje Golfský proud?) A taky to podle mne komplikuje úspěšnost draků v Alpách (kde o nich, mimochodem, zprávy moc nejsou).


4) Je to velké... mimochodem, jak moc veliké? Mne přijde těch tradičních třicet metrů nesmysl - co by to lovilo? Slony? Já bych osobně nešel nad velikost pteranodona (osm metrů rozpětí, ale jen asi metrák váhy, a možná ani ne...); tak nějak mi naskakují různé drakobijné obrázky, a na nich jsou draci - soudě podle velikosti drakobijců, případně koně - ve velikosti řádově metrů (tipnul bych to od tří do pěti...)
Vím, že existovali pterosauři větší (viz můj namibijský odkaz), ale africká příroda je přece jen o dost výkonnější, co se týče zdrojů potravy...

5) Hory k lítání - tady vidím potíž. Ty velehory by působily zmíněné potíže s teplotou (pro naše účely zejména Alpy nebo Kavkaz). Malé hory - například české - jsou zase plné stromů. Takže se nám množství vhodných hor hodně redukuje... ale zase to není tak beznadějné - například mne napadá naše Středohoří, Harz, Kaledonská vysočina a podobné útvary...

6) Problém s lesem. Potvrdil jsi moje nejhorší obavy. Škrtám velkou většinu Evropské mapy. V čechách nám zbývá vlastně jen ta Polabská rovina, vhodně doplněná tím středohořím (takže by ke střetům lidí a draků došlo zřejmě dost brzy, s fatálním výsledkem pro draky... ten kanovníkův drak roku 1138 mohl být klidně taky poslední...)

7) Pobřeží. To by mohl být dus ex machina. Jestli máme v Evropě něčeho překvapivě hodně, pak je to pobřeží (snad žádný kontinent nemá tak složitý tvar). A tady je možná vše, co je potřeba; skály k rozletu a hnízdění; spousta různorodé potravy (z moře i té ze země, co se zašla na pobřeží podívat. Delfín je sakra veliký. Mně by stačila doráda, tuňák nebo tak něco). To by dojisté míry rehabilitovalo to Norsko.

Problém. Proč jen se mi zdá, že zprávy o dracích mají těžiště v severnější, Atlantské části Evropy; narozdíl od zpráv Středomořských, které jsou divné a zmatené (ti Řekové, kteří nejsou to pořádně odlišit hada a draka?)
Je to jen můj dojem, že civilizace, šířená z Egypta (a bez draků), narazila později v Řecku na zprávy o dracích, se kterými si moc nevěděla rady (neb draci byli ještě severněji?)
Mohlo by to souviset s tím, že Středozemní moře bylo civilizované mnohem dřív; takže případné draky vyhubilo už v pravěku...?

8) Bažiny. Ty bažiny mi vrtají v hlavě z původní verze Dimophodona. Máme v Evropě bažiny - zejména v Bělorusku a Litvě a okolí; a je to šílená díra málem dodnes; je tu ale opačný paradox - zpráv je odtud tak málo, že se možná nedochovaly... (první litevské písemné památky jsou prý z počátku 14. soletí). To už by to mělo být s draky velmi nahnuté...

9) Číhající lovec - nejsem si jist, jestli je to proveditelné s něčím lítacím této velikosti. Jinak ti krokodýli nám v tom dělají bordel od počátku (ta sežraná svatá Markéta podle mne souvisí spíš s krokodýlem).
Spíš bych se díval na ty Wothanovy kormorány, orly mořské a podobné věci...

10) Navíc mne napadá, že nálezy pterosaurů jsou na potvou nejčastější v Evropě. Může za to možná kvalitní fosilní záznam; nebo to, že je tu nejvíc archeologů; ale je to tak. Konkuruje jen Severní Amerika (opeřený had?? - tady jsem se přiznal mnohokrát k bezradnosti).
A Čínské draky bez tebe, Fando, nerozsvítíme. Nemám ani ponětí, odkdy ty jejich dračí mýty vlastně fungují. Mají Číňani nebeského draka?
argonantus2.4.2003 (10:22)
Elder:
tady moc nemám, co bych dodal. Zaujalo mne:
- vivern - vysvětluje Divousovu poznámku o podobnosti s heraldickým drakem - to JE heradický drak; a opět od renesance (jak je to dozadu, marně hádám - ten atraktivní kyjovitý ocas, popsaný Fandou, může být nový nápad)

- sanskrt - DARC. Takže JE takové indoevropské slovo; má se ale za to, že znamená něco jiného. Pozorovat, být na stráži - to není špatné (být na stráži před draky?). Také možná vidět draka - žasnout. Vyvolává to víc otázek, než odpovědí.
Fanda2.4.2003 (13:17)
Argonantus:
Nejprve malá poznámka k tomu, cos odpovídal Elderovi - ono to "pozorovat, byt na stráži" nakrásně může souviset s funkcí draka jakožto strážce (pokladů a jiných věcí).

No a teď k tomu mému popisu:
- ten číhající lovec byl myšlen pro tu bezkřídlou formu
- na tom letu se asi shodneme
- otázka teplokrevnosti (homoiotermie) je záhadou i u těch dinosaurů - osobně se přikláním k tomu, že rozhodně draví terapodi byli endotermní homoiotermové (stálá teplota a sami si vyrábí dostatek tepla), velcí sauropodi pravděpodobně exotermní homoiotermové (stálá teplota, ovšem teplo přijímají z vnějšku, což je umožněno jejich velikostí - říká se tomu tuším gigantotermie). Problém máš ale s tím aktivním letem - všeobecně se soudí, že k tomu, aby zvíře mohlo lítat (a ne jen padákově plachtit) je ona "teplokrevnost" nezbytná a tuším, že ani u těch pterosaurů o ní téměř nikdo nepochybuje (teda až na tu sekernatku, ale ta nebude lítat moc dlouho a navíc nevím přesně, jak to má ta udělané s oběhem, krom toho její tělo je něco mnohem menšího a je-li to tropická ryba, což myslím že je, tak tam by ty vody mohly být docela teplé) - ono i to plachtění je sakra náročná věc (zkus držet ruce 2 hodiny rozpažené a uvidíš sám). Krom toho při té velikosti několika metrů (na které bych se s tebou shodnul) by to nemuselo být tak strašné. A ta velikost srdce? I di ty - kdyby vše záviselo jen na srdci, jak velké by ho asi musela mít taková žirafa? (zdá se mi to, nebo narážíš na ten článek z National Geografic?)
Dle mého, byl-li by drak, měl by být homiotermní a velmi pravděpodobně i endotermní. Pravděpodobně by pak ale musel mít nějaké zařízení v tepnách vedoucích do krku - buď tepající arterie (jakási "přídatná srdce", nebo záklopky, jako to má žirafa). No a kdyby na zimu migroval, odpadli by ti ty problémy se zimou na velehorách v zimě.
argonantus2.4.2003 (13:32)
Fanda:
díky za mnohem odbornější vysvětlení homoiotermie - asi máš pravdu. Závěrem je ovšem určitá zvýšená žravost draka ve srovnání s jinými plazy podobné velikosti (o čemž podle mýtů, mimochodem, není pochyb).

migrace - jo, to mne nenapadlo; a ještě máme v záloze zimní spánek, který by nám řešil potíže s místy, kde jsou velké výchylky teplot (ty severovýchodní bažiny)

ad zbytek mého desatera:

5) a 6) - z čirého vlastenectví (nevědeckého) - co říkáš tomu Středohoří, odkud se spouští draci na polabskou rovinu, aby tam přepadali nebohé rolníky?

7) Co říkáš pobřeží? Jeví se mi být velmi důležité... speciálně - co s Británií nebo Norskem?

8) Co říkáš severovýchodní bažině? Není tam zima?

10) Trvá - Mají Číňani nebeského draka?
argonantus2.4.2003 (13:53)

Přátelé, stran další významné blížící se mety - technický dotaz:

Nemáme založit Draky II? Nebráníme šílenou délkou fóra jiným v diskusi?
A nebo naopak přerušením zrušíme kouzlo?

kdo chce, ať řekne názor - já nevím...
Jirka2.4.2003 (14:24)
Já nejsem velký expert na slovanské draky, jen jsem něco o tom četl. Drak byl nejspíš pro Slovany symbolem síly, což částečné spojovali s plodností.

Jirka
argonantus2.4.2003 (14:26)
Jirka:
děkuji za bleskovou odpověď. Nicméně- kde jsi to četl?
Darkelf2.4.2003 (14:43)
Argonantus: Do pětisstovky a pak draky II, mě sse to už zdá taky dlouhý. Jinak by někdo mohl udělat přehledný výtah a obssah draků I.
Darkelf2.4.2003 (14:50)
Fanda (znovu šesst nohou): Tohle ssamozřejmě důvod není. Ty uvažuješ pouze o tom, že zaměníš geny pouze v jedné čássti. ale co když změna genů probíhá i na jiných čásstech DNA (proto je DNA tak variabilní - jinak o exonech a intronech sse bavit nebudu, ve škole toho mám až nad hlavu...tedy jesstli byss říkal, že už sse nový geny nemají kam vlézt)
A ještě jinak: Pokud by jssi byl hmyzák nebo houba ss rozumem, taky by jssi určitě zavrhoval čtyřnohé organissmy (ale geny do toho netahej, těm nerozumí nikdo! a těch kombinací je tolik!)
Darkelf2.4.2003 (14:52)
Fanda: Draco europeanus.....hezký popis wýverna.
Fanda2.4.2003 (14:56)
Argonantus:
- Z čistě vlasteneckého hlediska klidně
- pobřeží jsem myslím rozebral dost a obecně si myslím, že je to jedno z možných působišť
- severovýchodní bažinou myslíš co? Finsko? Jak už jsem psal - v bažinách asi jen pozemní formy. Jinak pokud jde o výskyt plazů na severu - zmije obecná a ještěrka živorodá jdou až za polární kruh a asi nebude náhoda, že jsou to živorodé druhy (možná jen vejcoživorodé - přesně nevím - musel bych se juknout do nějaké moudré knihy).
- Číňani a nebezký drak - pokud myslíš jako "mytologické stvoření", řekl bych, že asi ano, když už ho mají i Japonci, a pokud myslíš jako souhvězdí, tak bych řekl, že určitě, když je to součást jejich zvěrokruhu - ale více o Východních dracích, až si najdu čas znovu skouknout ty Legendy dračích císařů, co se mi válí doma na polici.

A pokud jde o založení Draků II - tedy nechť poslední příspěvek zde je zakladatelův výcuc toho nejpodstatnějšího.
argonantus2.4.2003 (15:08)
Darkelf:
ty jsi maniak, s těma šesti nohama. Tobě se zkrátka líp líbí čtyři nožičky a křídla... jsi skutečně obětí novodobé fantasy...

ale zkus na chvíli připustit, že nejde jen o nožičky; že chyba je v celkovém tělesném TVARU toho zvířete...

můžeš mít funkční tvar vysloveně podlouhlý (had, krokodýl) - ale ten prostě není k létání; jen v malých rozměrech lze vymyslet takový kompromis, jako Draco volans...

nebo můžeš mít funkčního létacího ještěra, ale ten vypadá ÚPLNĚ JINAK, než krokodýl s křídly... a řešení není ani Tyrannosaurus s křídly (s touhle představou v hlavě jsem se dost potýkal, když jsem vytvářel Nigreona...), protože by to bylo příšerně těžké monstrum, a ta křídla by pak vyšla úplně zběsile obrovská (kdoví, jestli by létajícímu karnosaurovi těch třicet metrů stačilo).
Ptakoještěři mají posunuté nožičky hodně dolů, a pohybují se vzpřímeně, jako ptáci (pokud se po zemi vůbec pohybují - asi nic moc). Rozhodně je pro ně nepřirozené ležet na břiše jako krokodýl. K čemu jsou pak dobré ty nožičky nahoře??

Co se týče případných manipulací s kořistí (a s prsteny, knihami apod.) - to řeším těmi drápy na křídlech, které ptakoještěři skutečně měli (a má je současné mládě ptáka hoacina, takže se umí chytat křídly větví), které vypadají pole mne dost efektně, (navíc je možné, že drápem lze probodnout srdce kořisti, jak činí Nigreon - tohle je, budeš se divit, vypůjčené od toho Kongamata)
samozřejmě, i ptakoještěr může mít dost dlouhý ocas(s kormidlem, jako Ramphorynchus), ba i dlouhý krk - ale to na celkovém ptákovitém tvaru těla už nic nemění...
Darkelf2.4.2003 (15:14)
Argonantus: (hej rychle založ draky)
A vy zasse všichni považujete draka za kuss ještěřího massa, čímž sse ztrácí jeho moudrosst. Zapomínáte na jeho magii a jeho zručnosst. Co když prosstě na něco volné přední končetiny potřebuje?!
Jinak tvůj pohled odkazuji na améby: Tém je taky divné, proč máš ruky, když ssi vlasstně můžeš všechno obalit tělem?!
argonantus2.4.2003 (15:20)
Draky II založím, až provedu ten výcuc, který má smysl jen v tom novém fóru...
- dnes už tady můžeme - ba co dím - musíme - vydržet...
elder2.4.2003 (16:06)
Konečne mám trochu času, tak sa tiež vyjadrím k tým biotopom. V niečom budem možno opakovať to čo už bolo napísané Fandom alebo Argonantom.

Najskôr ako si draka predstavujem:
Plaz, endotermne homoiotermný (predpokladám, že je jedným z vrcholných evolučných stupňov plazov a už taký krokodýl má k teplokrvnosti blízko, ako to bolo u dinosaurov nechám na paleontológov). Aktívne lietajúci. Veľkosť rôzna - od 1,5m po max. 15m (s chvostom) - závisí od životného prostredia - biotopu.

Počítajme teraz z obdobím do stredoveku, vrátane (možno posledný výskyt drakov v Európe).
Základom je veˇkosť potravinovovej základne. Preto som skeptický k výskytu väčších foriem v Európskych horách. Tie by väčšieho draka (nad 3 m) neuživili v žiadnom prípade. Keďže predpokladom je teplokrvnosť, nemožno počítať s vlastnosťou plazov vydržať dlhé obdobie bez potravy v aktívnejšom stave (maximálne pravá alebo nepravá hibernácia). A teda situácia, že raz sa nadlábne zdochlín kamzíkov a kozorožcov zmetených lavínou a potom má mesiac dietu nepripadá do úvahy. Pravidelná strava je potrebná a jej množstvo závisí na veľkosti.
Lov v priľahlých podhorských lesoch, na potravu bohatších, je takisto pre väčšie formy nemysliteľný pre Fandom spomínané riziko zranenia (pre porovnanie - aj minimálne zranenie pre dravé vtáky môže mať fatálne následky. Predpokladajme, že drak má takisto ako vtáky, odľahčené kosti. Čo s nimi môže spraviť náhodný náraz do stromu?) Preto do lesov a respektíve džunglí (lovec opíc), možno umiestniť len tie najmenšie formy. A lov hospodárskych zvierat = nespokojnosť sedliakov = hrdina drakobijca (celá tlupa :-)) = mŕtvy drak (a väčšina tlupy drakobijcov :-)) = výskyt draka len v kronikách.
Z toho vyplýva: Hory pre množstvo potenciálnych úkrytov a hniezdisk (jaskyne krasových oblastí) a relatívnu nedostupnosť mohli pre väčšie formy maximálne slúžiť ako hniezdny biotop. Za potravou museli inde ale zas nie cez celý kontinent. Tam kde sú otvorenejšie priestory. Lesostepy a stepi (savany, prérie). Ako ideálne lovisko najväčších drakov si predstavujem americké great plains pred príchodom európanov (a číňanov :-)). Z takého bizóna sa mohol drak nažrať poriadne. A veľkosť pôvodných bizóních stád je povestná, takže by sa uživilo dostatočné množstvo drakov (na vzlet z rovnej pláne je potrebný ten aktívny let, možno z rozbehom - úchvatná predstava:-)). A Skalisté hory na úkryt sú neďaleko. Paráda! Dračí raj! Prečo práve odtiaľ sú známe skôr hromové vtáky? Kompetícia? :-)
To čo o amerických prérijách platí aj pre africké savany a ázijské stepi ale aj tundru (sezónne sobie stáda, ale zrejme menšia veľkosť drakov).

Otvorený priestor + dostatok potravy + horské úkryty neďaleko = veľký draci.

Ďalší veľký draci sa mohli vyskytovať na tých pobrežiach morí a oceánov. Špecializácia - rybožravosť. Možno vedeli aj plávať (vodní draci, morské hady). Staroveké a stredoveké rybárske techniky populácie rýb skoro vôbec neohrozovali a znečistenie nebolo takmer nijakým problémom. Morských drakov mohlo vyhubiť práve drancovanie morí a "ropné škvrny" v novoveku. Pobrežné útesy bývajú často prederavené jaskyňami, takže úkryt máme tiež.

Močaristé biotopy. Asi naozaj len tie nelietavé formy a menšie. Tej potravy tam na veľké obludy nie je až toľko (viac vtáctva ako veľkých cicavcov). Alebo aspoň veľmi riedky výskyt drakov. Ale potom vyvstáva problém s rozmnožovaním. A riziko zvyšuje každé zmenšenie populácie. Trochu by to riešila dlhovekosť drakov ale nie dokonale. Možno preto ich už tak dlho nikto nevidel :-).

No, možno trohu zmetene, ale snáď k veci :-).
Fanda2.4.2003 (17:35)
Elder:
Kolego, rád bych Váš skvělý příspěvek doplnil.
Ideální by pro draky byl tedy i Kavkaz, popř. Ural - do velkých ruských stepí to tam také není daleko. Nutno také podotknout, že dříve bývalo v Evropě více kusů zvěře než nyní a to i té velké - např. takový zubr - ale je pravda, že to je zvíře spíše lesní narozdíl od svého amerického bratránka.
Pokud jde o problém rozmnožování - mohla by to řešit partenogeneze, která je u některých ještěrek a hadů doložená - vše by to pak byly dračice.

Argonantus:
Dle některých rekonstrukcí mohli, alespoň primitivnější pterosauři, celkem čile pobíhat.

Darkelf:
Nejradši mám lidi, kteří když něčemu nerozumí, automaticky předpokládájí, že tomu nerozumí nikdo.
Já jsem čtvernožec a šestinohost mouchy, jakožto členovce, mi divná nepřijde. Šestinohost draka, jakožto obratlovce, divná je.
Kromě toho problému s Hox-geny, který jsem rozebíral už na začátku a které mají opravdu fatální vliv na stavbu těla, je tu možný dedukční pohled evoluční (a geny k tomu potřebovat nebudu) - vem si to takhle:
Drak je bezesporu obratlovec a má šest párů končetin.
Všichni ostatní obratlovci mají 2 páry končetin, někteří méně.
Z toho vyplývá, že původní stav (a dá se doložit třeba embriologicky) je mít dva páry končetin.
U Tvého draka (Draco darkelfii) by muselo dojít ke zdvojení jednoho páru končetin - dle kreseb zdá se, že prvního.
Pravděpodobně by to muselo být ve stádiu, kdy původní přední končetiny měly tvar kráčivé nohy, tudíž duplifikací tohoto páru by vznikly dva páry kráčivých končetin v přední části těla.
Nyní by se mohlo zdát, že jeden z párů by byl k nepotřebě a mohl by se tedy vyvinout (ačkoli jaký selekční tlak by k tomu vedl, nevím) v křídla (pravděpodobně by spíše zdegradoval).
JENŽE mít o jeden pár nohou navíc, to je drahá sranda - za všechno se platí a zde energie, kterou tento nebohý jedinec vrazil do jednoho páru nohou by mohla být využita jinak - do růstu, nebo do rozmnožování. Navíc než by se tak stalo, obávám se, že by se mu ty nožičky vepředu pletly.
A jelikož evoluce je slepá a neplánuje a vždy musí pracovat s tím, co má po ruce, tak velmi vzdálená vyhlídka na takovou evoluční výhodu, jakou by asi let u takovýchto draků byl, bude přemáznuta okamžitou výhodou rychleji se množících a obratnějších čtvernohých draků.

Něco jiného je, pokud do toho budeš míchat magii - ta s evolucí nemá společného nic a tak takoví draci mohou být šestinozí.
darkelf3.4.2003 (9:13)
Fanda:
A co lalokoploutvé ryby?! Tam nelze mluvit o čtyřech končetninách (pokud vezmeš v úvahu ssvalnatou a pohybující sse hřbetní ploutev). Pokud naražíš na ty obratle.
Tahle energie vložená do dalších končetin není vubec marná, jenom possílit metabolissmuss.
- Ty tvoje Hoxgeny mají letální vliv na určitou ssekvenci. Jenomže pokud sse ssekvence mění, mění sse také jeho vliv a vliv jejich mutací. K tomu nepočítám taky k využití nějakého zbytkového intronu pro tyhle geny. (lze ještě podotknout, že je docela možné, že to také nemussí být šesstá končetina, ale pouze prsst)
Evoluce je tak nerovnoměrná (a to už někdo propočítal...a je z toho jedna ze záhad...něco o tom, že každá hmota je do určité míry nějak naprogramovaná...ale to jinam)
(když mají obratlovci méně končetin než dvě, není ssnad nemožné aby měli šesst....jinak ssi teď vzpomínám na šesstinohé kachny, no jo, oni totiž přežijí, ssice nohy mají minimální sschopnossti, ale čassem)
A co takhle ocass, další končetina a u některých tvorů dokonale chápavá.
- Není embrio jako embrio.

- a nebo je to duplikací krídel blanitých, že? Proto považuji Wyverny jako příbuzné drakům. Anakonec sse taky utápíš v pravděpodobnossti, takže ssám nevíš!
(drahý ššpáss to je, draci sse nějak extrémně nerozmnožují a rosstou několik tissíc let). Pletly a jak prossím tě?

Výhoda??? Víš vůbec ty, co udělali chápavé ruce z lidí???? a mít k tomu ještě křídla....mno jaká výhoda. Wyvern je prakticky nepoužitelný (kromě hor). protože pokud nechytne něco v letu a v letu to neuchvátí, končí na zemi, což je docela problém. Vrhání jedu je pak naprosstou zbytečnosstí. Měj ssi ssvého sskákajícího kanára, já mám ssvoje draky.

Magie a evoluce mají ěco do ssebe!
darkelf3.4.2003 (9:20)
Fanda: Já to dán na Draky II, tak tam i odpovídej.
argonantus3.4.2003 (9:20)
Hle! Upozoňuji, že Draci II již existují!


Bude ovšem nutno přenést vaše nejdůležitější myšlenky, které jsem vynechal v Summě, a případně ty, které došly po uzávěrce...
Argonantus12.6.2003 (11:23)
Tohle jen tak pro pořádek - chci mít tohle fórum po ruce.

Nepište sem - pokud něco chcete, dejte to na Draky II!
Darkelf18.6.2003 (11:19)
Sem vůbec nepíšu :-)
S.U.P.8.7.2003 (12:57)
ja taky ne..
argonantus21.10.2003 (13:10)
Údržba!
Já sem taky nepíšu!
Argonantus5.1.2004 (8:37)
Nepíšu sem; ale ono je tolik nových témat... že to co chvíli zapadne.
Jerson27.8.2004 (11:33)
Tahám toto téma nahoru, aby bylo pohromadě s ostatníma. Netřeba sem cokoliv psát, od toho jsou Draci IV (a v budoucnu možná pokračování).
Argonantus17.11.2005 (17:00)
tak polezte, draci... pokolikáté už...
Argonatus4.5.2006 (8:55)
...