Pevnost - Draci 1

Tato diskuze byla převedena z bývalého diskuzního fóra na www.pevnost.cz. O původní fórum nebylo pečováno a zanášelo se spamem, tak jsem se rozhodl ho zachránit. Zde si můžete celou diskuzi přečíst, tak jak byla postupně vytvářena.
Pokud má někdo nějaké dotazy nebo připomínky, nechť se mi ozve na email flaiming@draci.info.

Draci I | Draci II | Draci IIII | Draci IV

Vyhledávání:


argonantus25.2.2003 (9:37)
Ale, co pod elfov a trpaslci - DRAKY to chce!!
Redakce zkusila tohle tma v norov Pevnosti. Bylo to pkn (zejmna Divousv heraldick lnek), nicmn myslm, e toho bylo dost mlo. Jedna povdka... bsnika... draci ohn, vody a nebes... dra lod... Arawathv lnek...
ale pijde mi to trochu mlo, Antone Pavlovii! Co drak jakoto alchymick symbol? Jak to vlastn bylo se svatm Jim (a Michaelem i Marcelem?) Co antit draci? A co drakodlaci? Co to hlavn - jak je to s draky doopravdy?

Take sem s draky; my tm hnusnm "ahaves" ukeme!
Draco25.2.2003 (9:47)
Viiiiiiiiiic draku, viiiiiiiiiiiiiiiiiiiiiiiic draku
Wothan25.2.2003 (10:00)
Be, co je to za zvrstvo tak Drakodlak?
argonantus25.2.2003 (10:18)
J mm dojem, e drakodlaka vynalezl jaksi mimochodem Tolkien. V Hobitovi je nkde zmnka, e "radji bych el bojovat s drakodlaky na posledn pouti". Nic vc.
Potom se toho chopila komerce, toti Altar, a zavedla Drakodlaka jako jakousi ultimtn potvoru.
Nezvisle na tom mli odedvna nkte draci schopnost mnit se v lidi (viz napklad Ciruelova kniha; tak Sapkowski a jeho zlat drak). Jsou to ovem nikoli lidt "dlaci", ale je to obrcen - draci, co pedstraj, e jsou lid.
Cel ta mylenka je msi fascinujc, a urit o n jet uslyme.
Na druh stran pedpokldm, e pro Star draky z doby ped Pdem mus bt jakkoli mylenka na nco podobnho odporn; lid jsou pro n potomky krys. Mnit se v lovka pro n mus bt stejn lkav, jako pro ns mnit se v hada. Je v tom nco chylnho.
Wothan25.2.2003 (11:25)
Aha. Mimochodem mme na webu zajmav lnek o dracch od kamardky restaurtorky - pvodn to byla jen ploha k restaurtorsk zprv, ale vydalo to na docela slun lnek pro n web: http://www.wothanburg.cz/drak.html
Argonantus25.2.2003 (12:21)
Dky, Wothane - ten odkaz stoj docela zato.

Nikdo zatm nezmnil tu alchymickou rovinu vci, kter je dost dleit. Obraz probodenho draka (a Svatm Jim, nebo nkm jinm) je dost dleitm obrazem t snad vbec nejtajnj prce; nen nhoda, e provz lidsk djiny prv v tch mstech, kde njac alchymist byli (ecko, Byzanc, kesansk Evropa - zejmna Francie - od poloviny 12. stolet.)

Krom toho ern drak je zrove Merkurius.

A pak je tu jet stejn "proflknut" obraz zpasu Lva a Draka (povst o naem Bruncvkovi, napklad), zejm z te doby.

Souvislost heraldickch barev a alchymie je vbec hlubok; nen nhoda, e se objevily na na scn skoro zrove (polovina 12. stolet), prv jako tehdej mda marinskho kultu (viz Lilith, na kterou jsme narazili v hermetismu).
darkelf25.2.2003 (13:53)
Drakodlaci je jenom dal vplod pomaten lidssk namylenossti o dokonalossti jejich genov vbavy a nekonenmu ken ss osstatnmi druhy!
Argonantus25.2.2003 (13:58)
Urit. Pokud tu vc nevymysleli draci - heretici.
Nebo dokonce elfov, ty jsou pro kadou vymylenost.
darkelf25.2.2003 (14:04)
Wow, odpov rychlosst mylenky! Elfov maj cit pro realitu, take habara ss nedissciplinovanm oplodovnm drach vajec Humny je ponkud iracionln!
...jinak Drak Heretik? Nejssou ssnad vichni draci ve ssv podsstat neutrln?
Argonantus25.2.2003 (14:11)
J jsem pesvden, e ti, kter nazvm Sta nebo Pvodn, ti byli neutrln urit. Byli tu dv, ne cokoli jinho, lidmi ponaje, pes elfy, tpaslky a mon i Dobro a Zlo. Kdy mysl v milionech let, njak Dobro a Zlo se tam nevejde.
Jenome po Pdu se to muselo zmnit; prv v dsledku setkvn s jinmi rasami. Ti Pvodn na to kalali - ale urit s nkte nechali zlkat.
Jak jinak by mohli draci pijt k zjmu o zlato, nebo o mlad panny, nebo o dal pitominky? To u je jasn hereze; cesta od pravho a vzneenho dractv. ertv, jestli pak nkoho nenapadla ta ptkovina s drakodlakem.
darkelf25.2.2003 (14:18)
Dractv, to zn moc nadneen. Draci jssou ssice ssta, ale nejssou nejsstar. Dky nm ssnad ssvt pochop, e kdyssi dvno boj dobra sse zlem neexisstoval. Mon sse ssna obnovit ssvj pvodn sstar ssvt a tak kradou zlato, kter tak ovlivuje sspropadenou Humnsskou rassu (Trpaky nepotaje). Panny, kdy by ral panny? I kdy, mon je to ssymbolika toho, e u nesstoj o dal en lidssk rassy (ssnsst ensskou dv, ne zane rodit). A i pessto, to co lid povauj za chovn zla, je pouh chrnn teritoria a tvor, kte na nm ij ped lidmi.
Argonantus25.2.2003 (14:31)
A co je jet star, ne draci? Njak mne nenapad mnoho vc, kter by stly za e... hvzdy? Hory? Njakej vodn malej potvor? Nenapad mne nic, co bych si troufl nazvat Bytost...
darkelf25.2.2003 (14:37)
Nelze tyto sstar nazvat bytosstmi, protoe oni nepochzej z naeho ssvta (a kdo vlasstn pochz). Draci jssou jeti a zrova magit tvorov, mussel bt nkdo, kdo tm studenokrevnm jetrkm znalossti o magii pedal....ssnad ni tvorov jeho druhu...Lizardi, Illitid, Beholdei, ssnad i dmoni!
Argonantus25.2.2003 (14:52)
No j nevm... mne uili (draci), e na to oni (draci) pili sami.

Njac lizardi...! No tohle! To m by o?
A co se te dmon, sice nepochybuji, e ovldaj magii, ale njak mne nenapa, pro by ji nkoho mli uit.... a jsou vbec dmoni star, ne draci? Nen to zas njak vtvor nho psychina (a nemus to bt jen lidsk psychino... takov elfov s tm tak dost otravuj...)

Ti beholdei... to, to je tk - nejsou oni njak chobotnicovat tentononc? Pak by MOHLI bt star... Ale copak me vymyslet chobotnice nco opravdu svtabornho?

Tady nar na meze mch znalost. Jsem sice star, ale jsem jenom Argonantus. J to tko zkontroluju, jak to vlastn bylo... a hdej se s drakem a vysvtluj mu, e vlastn nic nevymyslel...
Wothan25.2.2003 (15:04)
Argonaut: co teba bakterie? :-)
Argonantus25.2.2003 (15:11)
Wothane, to mysl vn? Magie bakteri?
Wothan25.2.2003 (15:38)
Jen ty se piatou epic...
anonym25.2.2003 (15:45)
Mm dotaz na kohokoli, kdo bude nt as a chu odpovdt: Jakto, e se draci vyskytuj ve spoust civilizac, kter se nikdy nepotaly a nevdly o sob? Neznaly se, tak jak...
darkelf25.2.2003 (16:22)
Argonantus: Ty nezn Lizardy, jetr nrod. (Drak je plaz a hodn vyvinut ekl bych, tak nevidm dvod, pro by zaosstalej rassa nemohla bti sstar. Nehled na to, e maj sspolen 80% a vce genetickho kdu). A pokud jet z toho vylou extrmn potenci Humn a vzniku polohumanoid, je tahle alternativa reln. Bohuel neznaj tak dokonale ssvoji hisstorii a to je odssuzuje!
Netvrdm, e nkdo mussel uit pradraky (jisst tup perosstl jetrky) magii, co kdy ji okoukali (teba po dobu mnoho tissc let). A ssnad i pess jejich vynikajc pam (draci ji maj opravdu dobrou), byli znalossti pedvny z pokolen na pokolen. Pro by to nemohli bti dmoni, stejn ssiln, sstejn moud a dokonal.
Beholdei jssou tvorov sstejn ssiln jako draci. Pokud sse ti povede zabt Beholdera, tak je to pouze mladej kuss. A magie je ssousst jejich tla, co sse drakm zatm jet moc nepodailo. Nepodceuj chobotnice, zatm jssou pod dozorem, ale....
....a z drakem sse hdat nebudu, i kldy mm rd ssmrt, chtl bych k n pijt v jinch, mn bolesstivch okolnosstech.
darkelf25.2.2003 (16:23)
Bakterie nm vyarovali kysslm, mysslm? Take do urit mry jssou ve ssv podsstat kouzelnci.
darkelf25.2.2003 (16:26)
Anonym: No nevm co ti eknou osstatn, ale assi to bude tm, e kdyssi dvno na konci prvohor a v druhohorch ili tvorov (a to i v Antarktid), kte ssvoji kosstrou velmi blzce pipomnali Draky. A jeliko jejich kossti sse nerozpusstily dky kysselm dem, tak je nali, zpanikaili a utekli!
Fanda25.2.2003 (20:08)
Ano, to otzka - pro jen ti draci jsou vude... co j vm, tak minimln v Evrop, Asii a Americe?
Kdy by se na to lovk kouknul podrobnji, tak zjist, e rozdly mezi draky jednotlivch kontinent jsou velk co do vlastnost a u men co do vzhledu (emu se nen co divit - pibyl-li cestovatel do kraje, kde mli njakho tvora, kter vypadal jako velk jetrka, peloil to jako "drak", anto drak je velk jetrka).
Otzkou zstv, pro ale hergot velk jetrka (univerzl to rozhodn nen - tak nap. v Africe maj velk modr mosk lvy). Z sti je to, jak uvd Darkelf ve - ostatn jakkoli nlez velk lebky byl v Evrop pisuzovn drakm (a to i lebkm jeskynnch medvd), tedy, pokud to nebyla lebka slona - to pak byl Kyklop. Zde to ale vypad, e to nakrsn mohlo bt naopak - tedy nejdve vra v draka a pak a dodaten dkazy z lebek. Co j vm, teba to m, min. v Evrop, souvislost s hadem, kterho se pece jen dost lid boj (kdy u jsem u toho, vte, e velmi nepjemn zvuk, kter vydv kda vrzajc po tabuli je jako na potvoru velmi podobn opimu varovnmu signlu, kdy uvid hada?) a pokud vm, ani kesanstv se k nmu nestav nejlpe. Jene draci tu byli u za antickho ecka.
Mon to vzniklo z toho, e lidi opravdu maj strach z had a krokodl a co je horho ne had a krokodl? Velk had nebo krokodl n.b. s vce hlavama (co tedy byla u ek Hydra - e tento pochod nemus bt zcestn by mohlo naznaovat zve z trochu jinho ranku - Kerberos). Te m tak napad, e njak si nevybavuji draka u starch Egypan - jen velkho hada, a takt u Babylan (tam mli snad jen gryfa...)
A nesmme zapomnat i na takov ty miziv monosti, e nkde snad peili dinosaui dle, ne by se mnoh paleontolog nadl (nap. mekeke mbembe, i jak se to).
Na pvod drak v Evrop by bylo asi nejlep zeptat se njakho archeologa / etnografa. J si u vc z prstu nevycucm.
argonantus25.2.2003 (21:52)
Darkelf: U si vzpomnm, co jsou lizardmani - je to takov to v Might and magic, a za moc to nestoj. Ne, z toho se drak rozhodn vyvinout nemohl - morfologicky je drak od potku ltajc tvor (a star vyobrazen, kter ho vid jako hada, jsou taky vedle - je to zmotn star Egyptsk tradice had s draky. To vte, lid.) Had prost neme technicky ltat - m na to pln pitom tvar tla.

Mj osobn kandidt na pedchdce drak je potvora, kterou lid nazvaj Dimorphodon macronix (nebo nco dost podobnho, co se jet nenalo). Existovalo to ped 180.000.000 lety a vypad to dost asn. Velikost kolem t metr (pi evoluci se tvor zvtuje, take za sto milion let vvoje mohl bt dost ohromn), il v bainch a pohyboval se klouzavm letem v mstech, kde je dnes Britnie a Benelux (i kdy svt vypadal naprosto jinak). Jeho potomci mohli bt opravdu leckde (Pangea se jet nerozpadla), take to je souasn odpovd na otzku, pro jsou vude mon po svt.

Beholdei jsou zejm pkn ujetost (tak si na n vzpomnm v Might and Magic, byli pkn vytuhl); mon jsou dost sta; ale nenapad mne, pro by jejich magie mla jakkoli souviset s tou dra.

Fanda a Anonym: Vysvtlovn mtu draka pomoc krokodl (i varan a vbec had) neobstoj, protoe drak lt a tm pdem vypad pln jinak od samho potku (tvar tla pipomn dinosaura i ptka; stoj na zadnch). Drak tak v dnm ppad nemohl mt tyi nohy, kdy ml souasn kdla (estikonetinov tvor je ptkovina). Podle mne ml drpy na kdlech, prv jako ten mj dimorphodon, a souasn mld hoacina; do tch drp mohl koist klidn uchopit. U mnohokrt vda njak zve poprala, aby se pak ukzalo, e existuje (nebo existovalo v dob minul - zda draci vyhynuli, to je dal problm).
Argonantus26.2.2003 (9:18)
Fanda a Anonym: Ta kniha, kterou m Fanda asi na mysli, je o kryptozoologii napsal ji Jaroslav Mare - odtud je dajn existujc sauropod, jmnem Mokele mbembe. Mnohem zajmavj pro nae ely je pojednn o tvorovi, jmnem Kongamato, kter mon (?) reln a vdecky existuje v pralese Diundu, to je v mstech, kde se na map setkvaj hranice Zairu, Angoly a Zambie. Takov kongamato vypad jako drak pln nejvc ze veho, o em byla e - ltav tvor, dva metry rozpt kdel, velk hlava a dost hrozn zuby. Lov opice a obas i lidi, kdy na n naraz (mlokdy). ernoi se ho pern boj. Bl na nj narazili u ve dvactch letech (njak Anglian a francouzsk markz; pr dalch badatel, vetn Maree okolo r. 1970.)

Kongamato a Dimorphodon ovem nevysvluj zcela prapvodn Anonymovu otzku, kter je podstatn, protoe se vyskytuj bu hrozn dvno v ase, nebo v hrozn malm prostoru. Jak to, e kad civilizace, jakmile sleze ze strom, vymysl draka? A jak to, e se ti draci dost podobaj?

Mne fascinuje jet tet problm, kter by mohl uznat jako vdeck i psn Wothan nebo Divous. Jak to, e tato veobecn pedstava draka dv jasn biologick smysl? Vechny jin bestie toti, ponaje nejmn Physiologem, jsou potvory zjevn smotnovan ze dvou i vce zvat (gryfon, baziliek, mantikora), kter zjevn v prod t nemohou. Pokud je drak chpn jako "had s kdly" nebo "krokodl s kdly", je to tak zjevn smontovan. Jenome ta pedstava je tak vytrval, e spe vyvolv dojem, e jde o nedorozumn- popisy o tvora tak fantastickho a neobvyklho, e ho bylo nutno pirovnat k nemu znmmu. Pesn stejn problm byl ve stedovku napklad i se ralokem i velrybou (vyobrazen Leviathana tak stoj zato, a s velrybou maj mlo spolenho).

Take j stojm na t verzi, e draci reln existuj (nebo existovali a vyhynuli v dob, kdy o nich nejstar civilizace mohla mt povdom). Nejde o peivho dinosaura, nbr ptakojetra. Zn to nevdecky a fantasticky, ale pipad mi to jako nejjednodu a paradoxn nejspolehlivj vysvtlen Anonymovy otzky.
Wothan26.2.2003 (9:49)
Mn bav jak se me nkdo vn dohadovat o procentech obsahu "genetickho kdu" u fiktivn mtick bytosti jako je drak :-) Za chvli budete probrat konkrtn aspekty draho DNA ne? Pokud vn potebujete pitvat draky, asi vm stejn nezbyde ne se pustit do jetr a jetrek :-)
Argonantus26.2.2003 (10:01)
Ta procenta pinesl na scnu Darkelf - a pokud vm, nikdo s nm nepolemizoval. Pokud jsem dval ve kole pozor, 97% genetickho kdu VECH pozemskh tvor (vetn Wothanovch bakteri se piatou epic a Wothana samotnho) se shoduje - rozdly jsou jen v tom malm zbytku.
Nesmj se, a ekni jasn, vde - pro jsou draci vude po svt? A pro je tato pedstava konsistentn?
Wothan26.2.2003 (11:37)
No tak docela zace konzistentn nen - pece jen v pojet drak najde rozdly i v rmci Evropy, nato svta. Je podobn i kdy se pohybuje vesms od hada (ppadn okdlenho hada) na jedn k plazu (i vce nohmu) na druh stran. Konzistentn nen ani v tom co draci chrl i kdy se asto shuduj. Drak jako mtick postava je velmi star bytost, take bude mnohm nrodm spolen tak jako maj spolen koeny. Nco by se dalo vysvtlit tak kulturnmi styky. Pokud vychz pedstava ze zvat - plazi ij na vtin svtadl a nepodceoval bych lidskou fantasii - pokud ano, asi bychom se tu te a tady nebavili e? Stejn tak mohlo jt o chybn interpretace nlez - viz. teba dynosau "dra kosti" v n (nebo Barberiniho zaruen prav artefakty...). Kdy bude skeptik, snese na misky vah pinejmenm stejnou hromdku argument jako lovk kter se "existenci" drak pokus dokzat, ne-li vc. Jen to podle mne postrd smysl - dokazovat existenci mtickch postav...lf, drak, boh, per...
Argonantus26.2.2003 (11:55)
Wothan: Protoe mne ta pedstava mon relnosti drak msi vzruuje a napluje asem - stejn jako draci vbec a veobecn. To je jeden z dvod, pro jsem zaloil tohle frum.
Mm pocit, e to tak funguje i na dal vcemn vdeck typy - tu tvoji kamardku restaurtorku, kter jaksi nad pln vychrlila zajmav lnek; tebe samotnho, e jsi na t rekonstrukci mandlovho tu pouil zrovna a prv draka; Divouse, e napsal heraldick lnek o dracch, a zcela nad pln e jejich vzhled - a tak dl. Je ns docela hodn, a je to spolenost ctyhodn - od Tolkiena pes Louise Borgese nkam do starovku. ach!

Ale k vci - tvoje nmitka proti m dajn kozistentnosti drak je docela dobr; skuten se od sebe li, take to vypad, jako kdy se mluv o vce zvatech (had, plaz, krokodl atd.) Mj problm je, e jsem vc vnmal pouze jako jdro mylenky - LTAJC DRAV PLAZ, co konsistentn je.

Nemohu nijak dokzat, e se v pozad vech tch zmatench zprv a popis, vesms z ixt ruky, mezi jasnmi zmatky a omyly (brnnsk drak) skrv skuten reln vdecky neprokzan zve. Nicmn vzhledem k asnmu potu a vytrvalosti tchto zprv (od keltskch minc pes stedovk a k tomu kongamatu) to urit monost je.

A pro upesnn - tento zkladn problm (relnost drak, made by Fanda, Anonym a j) nem dn vztah k debat s Darkelfem o pvodu dra magie (kter je mn vdeck, nicmn ne nezajmav).
Wothan26.2.2003 (13:29)
Argonautus: mm rd draky jako mtick figury, to ve. Kdy chci na tt vmstnat symbolickou patronaci sv. Ji v njak pedheraldick podob a nechci tam malovat pravoslavn ikony (jednu mme na praporu, ale pro romnsk tt je to naprosto nevhodn) zbude nakonec zase jenom ten drak.

U t podobnosti - nkdy je obvm se pn otcem mylenky. Mimochodem okdlen plazi samozejm tak existuj dodnes ij. Svt je u pomrn mal msto aby se tu skrylo tak valk ltajc zve, pokud nkdy nco podobnho ilo stejn nezbude ne hledat foslie - a ty jsme nali i kdy ponkud starho data.
darkelf26.2.2003 (13:45)
Fanda: Rozdl mezi draky bych pissuzoval kosstrm rznch druh plaz, kter byli v t i on inkriminovan oblassti nalezeny. Jeliko v Evrop nebyli doloeny nlezy obch ssauropod, nemohli nai pedci nalzt dlouh hadovit ptee jako v Ssevern Americe nebo ve vchodn Assii, kde je pedsstava drako sspe jako velkho hada ne jetrky (i kdy nssk drak je mutant mnoha ruh zvat).
A jeliko nai pdkov nebyli tak hloup, ussoudily, e ob prothl lebky nemohou patit nikomu jinmu ne velk perosstl jetrce.
Argonantus26.2.2003 (13:55)
M-li na mysli drka ltavho (odnkud z Asie), ten existuje bezesporu. Nicmn i to je zejm falen stopa - technicky si neumm pedstavit, jak by tohle zve mohlo doshnout vtch rozmr, ne foxterir.
O existenci drak samozejm nelze kovanho skeptika pesvdit - dkaz prost chyb.

Nicmn pipomnm jet - ne to s tebou vzdm - skutenost, e lid o existenci drak vbec nepochybovali asi a do francouzsk revoluce; a o pr desetilet pozdji byla vda nucena uznat pravk ptakojetry. Take lid na draky dle vili, ne nevili (dnes v naprosto vemu).
Ostatn, argument o velikosti planety nen moc pesvdiv- pokud vzpomene na historii Latimrie, raloka Megachasma (zjitn 1976), okapi i tak banlnho zvete, jako je gorila. Ostatn, netrvm na Mareov kongamatu jako prokzan vci. Spe mi jde o dobu, kdy se takov zve mohlo velmi bezpen prohnt po svt (u ns rann stedovk, kdy vtinu plohy tvoil les; v Africe pinejmenm do pedminulho stolet), ani by muselo bt objeveno. I to se stalo - v, kdy vyhynuli ob ptrosi rodu Aepyornis nebo Moa? A to rozhodn nen mal zve...

Tak vnitn, mtick rovina problmu mne zajm. Jednak je to ta ndhern samozejmost, s jakou lid tehdy v draky vili.
A jednak ti tak pln nevm, e jsou pro tebe draci jenom vhodnm materilem na tt z tv oblben doby (mimochodem, u mn rovn zcela nejoblbenj, konktn doby krle Vladislava). Mohl jsi pout leccos dalho. Lva, kter je nemn univerzln. Orla. Gryfona (s tm si jsem mn jist). Urit kohouta nebo havrana. V pinejmenm stejn dobe, jako j, e s heraldickmi draky to u ns tak slavn nen (ten Vrada a Draick z Kunvaldu jsou o dost pozdj doba). A ten svat Ji - kter v t dob nijak zvl᚝ v md nebyl - piznej, e to je jen zminka! e tys tam prost chtl mt draka! ach!
darkelf26.2.2003 (14:02)
Argonantus: Morfologicky je teby drak ltajc tvor, ale jisst byl sschopn pouze klouzn na men vzdlenossti (pkladem jssou "Draco volans" drek ltav). To e jssou vbec sschopni letu, lze pissuzovat magii.
Tvj kandidt na draka Dimorphodon jisst vypadal hroziv, ale nedval bych jim pli velkou nadji (velk a jet k tomu ltajc tvor by assi katasstrofu na konci Druhohor nepeil). Mimochodem v t dob exisstovali vt druhy ptakojetr.
Nco mlo k beholderm: mn pipadaj velmi reln. Takov budouc pedci chobotnic (komorov oi, velk inteligence, chapadla) a kdy pitu k tomu jejich velkou adaptabilitu, mon nss podobn tvorov jednou nahrad.
a jejich magie nemuss bt sspolen ss draky, ale urit jssou sstar.

Evoluce nem pravidla, tak pro by nomohl mt esst konetin! (Drak)...a taky ss nima vypad lp....jinak j ossobn beru draka ss kdlama mssto hornch konetin za wywerna a neltajcho draka za Ssa.
Argonantus26.2.2003 (14:06)
Darkelf : tvoje odpov pila doprosted m reakce na Wothana. Take sorry za zmatek.
Nicmn tvoje poznmka o kostrch je tak na povenou. Rozhodn nelze vylouit, e nkdo nael ve starovku i stedovku pte a ebra sauropoda, co pi dnes uvaovanch dlkch pes 30 metr byl jist dvod k zamylen. nsk draky by to do jist mry vysvtlovalo (ale zase - co to ltn? Kostra sauropoda me vyvolvat rzn asn pedstavy, ale ltn nejmn ze veho!)
Hor je to s Americkmi. Hlavn oblast dinosaur je ve Wyomingu, Montan, Utahu, Novm Mexiku, Dakot, Albert a podobn. Opeen had je specialitou Stedn Ameriky. To je dost daleko... a navc, pokud vm, severoamerit indini opeenho hada neznaj.
A pak by ml bt hadovit drak v Africe, kdebyli sauropodi tak...
darkelf26.2.2003 (14:14)
Argonantus: Sspecifikuj pedsstavu sseveroamerickch drak.
No opeen hadi by sse dali vyssvtlit pedpokldanm malm kontaktem vyssplch stedoamerickch a jihoamerickch kultur. Zde pedsstava draka assi sspe tvorili velc krtii (anakkonda, hrozni). Okdlen had byl assi jejich jedin vyssvtlen bosstv. vichni lid, kdy myssleli na ssv bohy, kouali na oblohu. Quetssalcoatl, okdlen had, sse prosst njak mussel pohybovat po nebessch (a vude ltalo tolik ptk).

Tu Afriku bych vyssvtli assi tak, e v Africe sse za tu dobu udlo pli mnoho zmn a kossti dinossaur sse jen ak nepovaluj na vyprahlm pssku, jako je to teba na pouto Gobi.
darkelf26.2.2003 (14:17)
Ssspeciln pro Wothana: dra gen pro chrlen ohn TTACCAAGGTGAGAATCGTAAAACTGCATGCAATTGGCAGGCTTAGCAATGCCATTGCATGCAAAAACGATACGATCAGTACGATACGATACGACGACATACGCATGGCGGACT
Argonantus26.2.2003 (14:20)
Darkelf jet jednou:
K ltn Dimorphodona - tohle je dost sloit vc, protoe je hrozn mlo nlez. Klasick pozitivn vdec by ekl, e Dimorphodon sice m kdla, ale protoe ho nikdo ltat nevidl, tak neltal vbec. na ltn jsou rzn teorie, kter souvis s mdnmi otzkami teplokrevnosti. Star kola uila pouze o klouzavm letu na zpsob Draco volans (i kdy kdla jsou pln jin). Dnes se vyskytuj i zastnci aktivnho letu a zpsobu ivota (tohle petiskuje a shrnuje Mare docela dobe v citovan knize).

K-T katastrofa, ili Alvarezv meteorit, ili vyhynut dinosaur na konci kdy, ili to, emu km prost Pd: dal mdn zhada; zda nco peilo a kolik toho bylo, to lze ci opravdu tko. Dimorphodon zas nen a tak velk - je otzka, jak ho m; m dost velk rozpt, ale ne zas a tak velkou vhu, neb lt (nejve destky kil; v maximln verzi metrk).
Pro zrovna dimorphodon, a ne nco vtho - protoe to "nco vtho" paradoxn nen tak drav a agresivn, aby se toho nkdo bl, snad s vjimkou pteranodon. A protoe - viz Mare.

Beholdery vzdvm. Mtick povaha chobotnic je zajist hlubok a zsadn tak; i zde se skrvaj zejm rzn pekvapen; tak by lo vzpomenout na Cthulhu; ale to je sp na jin frum. Pro ns, pozemn stedoevropany, je to exotika.

Pro by evoluce nemla mt pravidla? Vda m pravidla; heraldika m pravidla; magie m pravidla. Pesto jsou na svt asn vci.
darkelf26.2.2003 (14:29)
Argonantus: Tady je otzka jesstli ta tvoje ltajc jetrka je pedek draka! Ssice do urit mry sse jednalo o teplokrevnho ivoicha, protoe byl sschopen vtho pohybu, ale pro ho sspojuje ss drakem? (J jssem tm sspe chtl naznait, m byli draci dve, ne sse sstali draky!) Pro takov tvory jako je drak je aktivn zpssob letu, jak jssi poznamenal, docela nemon. Tolik energie, co mus vynaloit, aby sse odpoutal od zem....fha...a kolik j potom t zemi ped....mno, docela by tm niil okoln krajinu.

Pokud by tuhle katasstrofu peil, mussel by sse bhem nkolik "desstek" let pizpssobit. Ale nen to moc rychle.......to zavn n jinm ne lidsskm ssmysslem pro realitu. (ale my, elfov!)

Vda nem pravidla, vda m pouze posstulta a to jenom proto, aby sse nho mohla chytnout. Magie by mohla mt njak pravidla!
Wothan26.2.2003 (14:47)
Darkelf: dkuji, to by pro klonovn mlo stait - zkusm to naroubovat na mloka :-)

Argonautus: je mi lto, ale tahle planeta je skuten pli mal na velk objevy. S vjimkou asi rostlin, drobnch organism, hymzu nebo moskch hlubin kde ns jet hezk dka zajmavost ek, vetn tch rozmrnch (z nejznmjch teba olihn-krakatice) bych na sou moc neszel. Pralesy se zmenuj a neprostupn msta jsou stle lpe zmapovan. Drak, a u vezmeme kterhokoli, by bylo pomrn velk zve - navc ltajc, nco takovho by se jen velmi obtn skrvalo kdekoli.
argonantus26.2.2003 (17:18)
Wothan: nemohu ne odkzat na moji repliku z 26.2. z 13.55, je cel urena tob, jen tam chyb Wothan v ele. A na tto pravd vesele chci zemt. :-)

Darkelf: S tebou je to sloitj. Zkusm rozmotat, co jsem dosud nezodpovdl.
Ltn - viz 14.20 na potku. Dopluji jen, e Draco volans lt principiln jinak, ne Dimorphodon. Draco volans m kdla z prodlouench eber, a to jednak neunese moc velk zve (odtud m teorie foxterira), jednak to skuten nelze ut jinak, ne jako rogalo. Dimorphodonova kdla - pipomnajc netop - umouj let aktivn; ve ostatn je vdej energie; a to, e by tm niil krajinu, je tvj ekologick elfocentrismus.

Zda je dimorphodon skuten pedek draka - co j vm? Jsem jen Argonantus, a tenkrt jsem chybl. Ale je to pro mne vtzn typ - nic jinho tak pkn nevyhovuje (dokonce, a to jen jako jemn plec pro Wothana - dimorphodon vyhovuje i jako zajmav pedchdce inteligentn bytosti. Je velmi mlo specializovan, kolektivn, verav, m obratn drpky. Dle viz Carl Sagan.)

A jet ti severoamerian: Prv e tam draci chyb (a jak by ekl sprvn Anonym, taky tam dlouho chybla civilizace). Promtnut obvan anakondy na oblohu je prv ten psychologick trik, ktermu jsem se chtl vyhnout (to by provedl Jung a zejm Wothan - ale a nm dvod existence drak ekne sm).

Pipomnm znovu, e had i jetr, a vbec jakkoli plaz znm v t dob je obzvl᚝ pitom kandidt na ltn. Pro necpali nai pedci na nebesa lva, hrocha, slona, medvda...? Pro to u vech vudy musel bt vdycky plaz, znova a znova? Tak se ptal Anonym, a tak se ptm i j.
Wothan26.2.2003 (18:22)
Argonaut: porovnej aktivn let netopra s aktivnm letem kondora...vm je to ptk, ale principieln jeho kdla umouj let aktivn, pesto je praxe ponkud jin.
Fanda26.2.2003 (18:49)
Uff, to je pspvk, take jenv krtkosti:

1) Nikde jsem nenapsal, e obhajuji relnost drka

2) Evoluce rozhodn nespov ve zvtovn

3) Evoluce je sice slep, ale m sv zkonitosti - 6 nohou by nap. chtlo dost sloitou mutaci v oblasti Hox-gen, vlastn jednch z nejzkladnjch stavebnch kamen organismu a udlalo by to dost velkou paseku

4) Pokud nebude nov druh pesvdiv doloen, je lpe bti skeptick.

5) Draco volans je agama z JV Asie a lt klouzavm letem - tum, e plachtch po svch ebrech

6) Kdla kondora umouj aktivn let jen na velmi malou vzdlenost - lt pasivn - placht.

7) Ppad lebky medvda vydvan za draka je dost vykien ppad. Ostatn prvn kost dinosaura (byl to Iquanodon) byla popsna jako Scorum Humanum - ti kte znaj medicnskou latinu, nech pelo tm neznalm.

8) V ppad drak by to asi opravdu chtlo vysledovat pvod tchto slov v jazyce - z eho vznikly, co znamenaly. Jinak to opravdu sklouzv k tomu, e se tu hdme o shod pojmov - ltajc jetra je zkrtka drak a naopak.

9) Dle souasnch teori se teplokrevnost pedpokld k nutnosti aktivnho letu.

10) Jak je rozdl mezi lvem s orl hlavou a orlmi kdli a hadem s netopmi kdly? Jinmi slovy i drak me bt jedna z tch skloubenin.

Tak je asi zatm ve.
Frelin26.2.2003 (21:00)
Hmmmmmmm... No chvli m to dalo ne sem se vbec dostal a na konec thle diskuze... ALe i j nco pidm... Draci, jeliko sou dost chyt, tak se mou ukrvat i v dnen dob... I kdy pralesy mizej, podle m jich je jet dost. A pak ltan a hadi. CO kdy njakho hada chytil ptk, had mu za letu spadnul a lidi si ekli: Had a lt!!! A z toho vzniknul drak...
darkelf27.2.2003 (8:12)
argonantus: Dimorphodon ml mysslm docela malej pomr hmotnossti tla ku kdlm i tak pochybuji, e by sse jen tak vznessl mvnm kdel ze zem. Vtinou vyuvali njakch tess (aliass Wothanv Kondor, tam sse opravdu o aktivnm letu mluvit ned). Jinak jak jssem naznail, i kdyby aktivn ltal drak, jenom pi vzletu by vznikla takov nrtazov vlna, e by v okruhu nkolia mert ltali sstromeky.
Vichni ptci jssou kolektivn a kam to vedlo?! Radi bych fandil chobotnicm!
Sseveroameriani jssou vyeeni a ltajc hadi taky!
Pro nenacpali pedci na nebessa lva, medvda a sslona? Koukni sse na hvzdy a pozn pravdu! I Gana um ltat! Pro zrovna plaz? Protoe!
darkelf27.2.2003 (8:22)
Frelin: A podzem je taky velk
darkelf27.2.2003 (8:22)
Fanda:

1) toss nenapssal
2) to teda nesspov
3) sslep nen, jde ss uritm clem...ale nkdy sse prosst mine inkem. Extrmn zmny chce extrmn podmnky - 6 nohou, pro ne?!
4) optimissti sse dovaj vyho vka, take draci jssou.
5) To vichni vme!
6) To ale drakum nessta (krtk vzdlenosst)
7) no jo, ale nebyli prvn, kdo je nali. A dobr hisstorky vydr dlouho.
8) to jo.
9) na zemi mon, ale nen nutnosst
10) ...?...?
Wothan27.2.2003 (8:28)
Fanda: uvdl jsem toho kondora schvln - je to hezk pklad rozporu k jakmu by mohlo dojt pokud by se porovnvaly pouze kostry - kostra kondora a kostry jinch ptk. Principieln by tu neml bt dn zsadn rozdl a pesto v praxi je. Jene kondora natst meme vidt v letu, dynosaury u bohuel ne take nad jejich fosliemi spekulujeme...
Argonantus27.2.2003 (9:51)
Fandovo desatero:
1) Relnost drak obhajuji j. Netrvm na n - neb kajcn doznvm, e dkazy nemm. Jenom upozoruji, e tu takov monost je. Kdy se poprv mluvilo na potku 19. stolet o ptakojetrech v pravku, tak se vichni smli.
O existenci drak v souasnosti nejsem pln pesvden; ale pro zajmavost jsem ekl, e i to tvrd partika zoolog (Mare, Mackall a dal - zjevn jsi to etl taky, Fando).
Daleko slibnj je monost existence drak v ne a tak dvn minulosti.

2) Zvtovn samozejm nen podstatou evoluce, ale v evoluci jednoho druhu bv typickm jevem (viz k, snad nejlpe doloen a prozkouman ada). Konkrtn - pokud ml dimorphodon kolem dvou metr rozpt, za sto milion let mohl mt nkolik metr (ale asi ne ticet, jak chce tradice).

3) est nohou je kravina. Na tom trvm. A dokonce mohu estinohou potvoru vysvtlit jinak - kdy zkoueli nakreslit ltajcho plaza se dvma nohama (keltsk, sprvn verze), zdlo se vtvarnkovi, e to vypad pln divn (a v hadovit verzi fakt vypad). Tak dv nohy pidali.

4) Urit. Taky nepeme disertan prci, nbr jen plodn tlachme. A mimochodem, stou skeps se to zas nesm pehnat. Jet okolo roku 1920 se vn tvrdilo, e svat Vclav je vybjen postava. Osobn jsem zail adu velkch pekvapen... ale to je sp na rum hermetismus.

5) Jo. A s draky to neme souviset.

6) Jo. Ale k ltn draka a jeho pedka nm to nevypovd vbec nic.

7) O tch kostech jsem u slyel dve, ale dostalo mne, jak trefn to pedvedl Darkelf. Mongolsk - nebo nsk, chcete-li - vlenk stoj v pouti nad kostrou velkho sauropoda... ml rozumn dvod o dracch pochybovat?
Tenhle obraz nm ale nevysvtluje vechno - jednak to ltn, jednak ty Kelty a eky.

8) To je pravda. S tmhle jsem zaal j. Povauji ideu ltajcho dravho jetra za neobyejn mocnou a vytrvalou, a vlastn dost zhadnou. To byl jeden z mch hlavnch argument. Jak s tm souvis pomrn jazykov vytrvalost pomrn panevropskho slova "drak", to nevm, nejsem odbornk.
A takov ppady, jako Draco volans z toho vyluuji jen pro dvody evolun a biologick (je to evolun paralela podobn, jako jsou delni, raloci a ichtyosaui - ppadn ptakojeti a netopi.)

9) Jo, to jsem prv tvrdil. Nicmn tady m pravdu Wothan - ltn ptakojetr je dost modern a sloit vda, kdy mme jen kostry - a u draka nemme ani tu kostru. Take u ltn se tko dobereme konen verze.

10) Zejm prv ne, a to je to zajmav. Kdyby byl drak opravdu pravideln a spolehliv kreslen jako had s kdly, pak m pravdu. Jenome zde je teba obrtit Wothanovu nmitku proti nmu - prv proto, e drak je kreslen pokad jinak (lnek t restaurtorky na wothansburgu, lnek Divouse a spousta jinch), vypad to, e jde o pokus o nkolikerou rekonstrukci podle rznch, nedokonalch zprv. Pedstav si duevn cvik - jsi stedovk mnich, a prv ses setkal s cizm kupcem, kter ti popisuje DRAVHO LTAVHO JETRA. Pouije pi tom - jak jinak - plazy, kter zn. Vsledkem tvho obrzku bude zbastlenina. A u rznch autor rzn (viz moje vaha o pidn nohou pod 3). Jak jsem ekl nahoe - pesn to sam probhlo ve stedovku s velrybami; podle vtiny kreseb bys velrybu nepoznal. A div se, kdy byl autor suchozemsk mnich?

Frelin: jen glosa k tvmu npadu - v jednom zpise kanovnka Vyehradskho, nkdy ze tyictch let 12. stolet, nemlm-li se, je lakonick vta "bylo vidti ltati hada."
Netum, jak a pro k tomu dolo - ale mimochodem, hada a draka dovedli rozeznat.
Argonantus27.2.2003 (10:04)
Wothan: Jo, a Wothane, ty jsi mi utekl s mm nevhodn osobnm tokem. Za masku chladnho vdce se pede mnou neschov. Ty m ty draky rd, piznej se - jinak bys s nmi tady neblbnul a nemaloval je na mandlov tty.

Inzeruji znovu - tahle psychick rovina drak mne tak zajm. Draci maj sv uhraniv kouzlo; kdo je na to nchyln, tak na n mysl a obas se k nim vrac. To je prost fakt; kdybych tu zaloil frum "mantikory" nebo"ltajc hroi", tak daleko bychom se nedostali.
Wothan27.2.2003 (10:37)
Argonaut: j jsem na to odpovdl. Mm je rd jako mtick figury (podobn jako spoustu jinch bjeslovnch postav), mm je rd ve vtvarnm umn a konen mm rd plazy...pesnji pedevm jetry.
Argonantus27.2.2003 (12:55)
Wothan: Jsi zatvrzel, miste. Nemohu ti dokzat, e "spousta jinch mtickch figur" nen pro mne, ani pro tebe pln tot, co drak. Mohu t z toho jen podezrat.
Takov amfisbna je sice zajmav, ale "jen" zajmav. Drak je proti tomu magie. Drak je ve. Drak je fantasie. Drak je provokace.
Vdli to u tenkrt; oficiln vysvtlen svatho Ji (a jemu podobnch obraz) je rzn - nboensk, hermetick a kdovjak symbol. Mm podezen, e to malovali taky proto, e tam chtli mt draka.

Obdivuji realisty; jet vce si vm tch, co jsou vm, m j nejsem (co jsi za, je jasno z fra "erm"). Nemohu ovem nepoznamenat, e my druz, nepon mgov, kte nevme, kterm koncem se me vlastn dr, jsme magi mn zraniteln - protoe o n vme. Ale to pat do jinho fra (hermetismus).
Bu zdrv a vytrvej. Wothanburg je geniln. Konec odboky.
Fanda27.2.2003 (16:09)
M desatero 2 Turbo:

1) J jen e jsem byl uvdn mezi zastnci. A Mare je kryptozoolog, co je banda divnch lid, asi tak jako ufologov, a k tm se slun zoolog nehls a vit se jim d asi tak jako domorodcm, tedy vbec
(teda ne e by zoologov nebyli divn, pr jich znm) ^_^

2) Jo, kon se zvtovaly. Nejdn se ale o njak obecn evolun trend - u kon dolo ke zmn potravn niky z prales na oteven pln, co si vydalo pestavbu konetiny a tak zpsobu zpracovn potravy. A abych ti vyvrtil tv tvrzen o obecnosti zvtujcho trendu v evoluci, jmenujme tebas obojivelnky - porovn-li ty prvohorn s dnenmi, vyjdou ti ti dnen men a to podstatn.

3) Hodin je slep, bme, abychom zstali na mst - to mota evolun teorie souasntosti - pokud chcete diskutovat o evoluci, pette si pro zatek ervenou krlovnu (a e to nen such etba). Evoluce nem smysl - jedinm smyslem je snaha splodit vce potomk / pedat vce svch gen dl, ne ten druh.

4) Na druhou ani s tm optimismem - pak se me stt, e lovk najde to co hled jen proto, e si to najt peje.

....

9) 2 Darkelf: Star Trek sem netahej - ty zn njak jin ivot, ne je ten pozemsk?

10) 2 Argonautus: A taky to me znamenat to, e vzniklo nkolik nezvislch pedstav, kter jen na zklad vnj a nedokonal podobnosti byli nkm, kdo o tom neml ani pru, pojmenovny stejn.

Jo a pokud jde o ty ltajc potvory - co takhle hominoidn tvor pipomnajc enu s opeenmi kdly na zdech - to je alespo v Evrop tak dost vykien ltavec.

A vbec, pro chcete, aby draci existovali? O em bychom potom snili?
argonantus27.2.2003 (20:06)
Fanda:
U ne desatero, jen posledn bod, kter je jet zajmav:
Pro chci, aby draci existovali? O em bychom snili?

Protoe snt o nem, co by bt mohlo, ppadn, co dokonce bylo, je daleko vce vzruujc. Podvej se na rubriku o ermu, a uvid, jak lidi jako Wothan zajm vhradn to, co bylo - ne zbastlen lenosti, kter bt nemohly. To je, o b zejm v cel Pevnosti. To je, co se pokoum vysvtlit na rozdlu mezi drakem a amfisbnou.

Ta vykien ltajc dma - to je prv to, co zcela urit bt nemohlo (a nejen proto, e m est konetin). U Tolkiena znan dopalovala, a j chpu, pro. Je to hor, ne amfisbna a mnohem hor, ne Darkelfv Beholder (kter je pece jen konsistentn a njak mtick podkres m.)

Byt a nebyt nen tak prost kategorie; jsou vci, co jsou o dost vce, ne jin vci; jsou vci, co nejsou, ale byly; jin vci nejsou a nebyly, ale bt mohly; pak jsou vci, kter bt nemohly, ale lze si je pouze pedstavit; a pak jsou vci nepedstaviteln, kter nejsou, nebyly a bt nemohly a nelze ani chtt, aby byly. ach!
h pedstav, kter jen na zklad vnj a nedokonal podobnosti byli nkm, kdo o tom neml ani pru, pojmenovny stejn.

Jo a pokud jde o ty ltajc potvory - co takhle hominoidn tvor pipomnajc enu s opeenmi kdly na zdech - to je alespo v Evrop tak dost vykien ltavec.

A vbec, pro chcete, aby draci existovali? O em bychom potom snili?
Fanda27.2.2003 (21:40)
2 Argonantus:
Je zhodno, e si to opt stoil zpt k drakm.
Jak je tedy vidt, i okdlench humanoid je kopa a j tm svm myslel kesanskho andla.
Ale zpt k tv reakci - njak ses v t rozshl filozofii sm zamotal a otzkou je, kam dt draka - pro m kategorie pedposledn (nebyl, ale dovedu si ho pedstavit). Pravdou tak je, e to co si dokeme, nebo nedokeme pedstavit tak zle na tom, co o dan vci (nebo j podobn) vme nebo nevme - a to plat tak o tom, co povaujeme za mon, nebo nemon. Ale nevm, jestli je snn zvisl na tom, jestli pedmt bt mohl nebo nemohl (pop. byl, nebo nebyl) - tvj pklad s ermem se mi zd ponkud zcestn, protoe o ermu mme tak njak vc dkaz jeho existence a ty nm u drak chyb - krom zkazek, ale lidi toho namluv. Je tak dobr pamatovat na to, e drak, jak ho znme my, je zkrtka symbol, ztlesnn majesttn hrzy (alespo tedy v Evropsko-kesansk tradici) - ostatn netop kdla se tak njak pifaovala vemu pekelnmu, a ert v, jak to s nm doopravdy bylo (a budu se dret radji v Evrop, protoe pes povrchn podobnosti nejsem sto ct, jestli "draci" jinch kultr s tm nam maj nco spolenho).
A njak nov moto zvrem (^_^): Kdyby draci nebyli, lid by si je asi stejn vymysleli.
Wothan28.2.2003 (9:07)
Kdo to promazal?!
Argonantus28.2.2003 (9:50)
Fanda:
1) Jo andl? To jsem nepochopil, myslel jsem na pedtolkienovsk elfy a vly. Pro by, u vech mantikor, mli bt andl ensk??

2) Ta filosofick rovina problmu je kardinln, a proto se k n vracm. S tm ermem - nen pochyb, e existoval. Nicmn je erm historicky vrn a fascinujc, je erm, kter bt mohl, ale nejsp nebyl, a je erm pln nemon, kter nkter lidi dopaluje. Neermuji, ale pln chpu, pro. Viz to frum (fakt tam zajdi). Vci, kter jsou in potentia mon (jak by ekl kolega Akvinsk) jsou prost mnohem zajmavj, ne ty nemon- a ty, co jsou skuten (in acto), ale my jsme to netuili, jsou pmo ohromujc. Tvoje golsao poteb draka m prv sem. Kdyby si nikdo nevymyslel amfisbnu, svt by byl sice chud, ale nic tak zsadnho by se nestalo.

Wothane, pomoz - biju se i za tebe!!

3) Odmtm, e draci nejsou a nebyli. To mi pipomn onoho neastnho papee ("kameny nepadaj z nebe, protoe si to nepeji.") Navrhuji kompromisn, policejn zvr : PTOMNOST DRAKA V DOB HISTORICK NEN MONO POTVRDIT, ANI VYVRTIT.

4) Nedvno zesnul Carl Sagan kal o mtick povaze draka zajmav vci. Lid - a potamo vichni primti - maj podvdomou hrzu ze vech plaz; v jejich snech figuruj plazi a hadi vrazn nejastji, hned po lidech (osobn poznamenvm - v mch jo.) Nejde nhodou o to, e plazi byli pro primty vdy tm nejhorm nonm nebezpem; nen to petrvvn dvn vlky s dinosaury v podvdom?

Wothan: Kdo co promazal, proboha?
Argonantus28.2.2003 (9:50)
Fanda:
1) Jo andl? To jsem nepochopil, myslel jsem na pedtolkienovsk elfy a vly. Pro by, u vech mantikor, mli bt andl ensk??

2) Ta filosofick rovina problmu je kardinln, a proto se k n vracm. S tm ermem - nen pochyb, e existoval. Nicmn je erm historicky vrn a fascinujc, je erm, kter bt mohl, ale nejsp nebyl, a je erm pln nemon, kter nkter lidi dopaluje. Neermuji, ale pln chpu, pro. Viz to frum (fakt tam zajdi). Vci, kter jsou in potentia mon (jak by ekl kolega Akvinsk) jsou prost mnohem zajmavj, ne ty nemon- a ty, co jsou skuten (in acto), ale my jsme to netuili, jsou pmo ohromujc. Tvoje golsao poteb draka m prv sem. Kdyby si nikdo nevymyslel amfisbnu, svt by byl sice chud, ale nic tak zsadnho by se nestalo.

Wothane, pomoz - biju se i za tebe!!

3) Odmtm, e draci nejsou a nebyli. To mi pipomn onoho neastnho papee ("kameny nepadaj z nebe, protoe si to nepeji.") Navrhuji kompromisn, policejn zvr : PTOMNOST DRAKA V DOB HISTORICK NEN MONO POTVRDIT, ANI VYVRTIT.

4) Nedvno zesnul Carl Sagan kal o mtick povaze draka zajmav vci. Lid - a potamo vichni primti - maj podvdomou hrzu ze vech plaz; v jejich snech figuruj plazi a hadi vrazn nejastji, hned po lidech (osobn poznamenvm - v mch jo.) Nejde nhodou o to, e plazi byli pro primty vdy tm nejhorm nonm nebezpem; nen to petrvvn dvn vlky s dinosaury v podvdom?

Wothan: Kdo co promazal, proboha?
Argonantus28.2.2003 (9:57)
Ksakru... dal kiks, tentokrt mj. To u jsem magor??
darkelf28.2.2003 (9:57)
Wothan: Te jssou nejnovj psspvky nahoe, taky m to dosstalo!
darkelf28.2.2003 (9:58)
Assi ssi udem psst mezi prssty, tak .......
darkelf28.2.2003 (10:11)
Fanda: (k poznmce ze SStar Treku)... velk nevhoda lid je ta, e dok pemlet pouze ve dvou rovinch (ssem tady a co sse kolem m dje, sse prosst dje vude, nic sse nemn, proda sse nemn!). Vechno m ssvoji logiku, ve m ssvoji rovnici ivota.....vechno b podle njak zvisslossti. Odchylky nejssou ppusstn! I had me ltat, ale pro by to dlal, kdy sse m na zemi tak dobe, pro by mli ryby aktivn ltat, kdy sse maj ve vod tk dobe, to e dn sstudenokrevn nelt, je pouze tm, e u nali to nejlep, co mohli (a nevzdali sse toho nkolik milin let)!
Argonantus28.2.2003 (10:12)
Darkelf: nebo chapadly.

Hele, jsou draci, nebo nejsou? A co tv elf podvdom o dracch? A co k lnku, kter se tu zjevil?
darkelf28.2.2003 (10:29)
argonantus:
Draci urit jssou, jako jssou elfov a TrPaci. Muss vit! Ssice to nen realita, ale kdo z nss v, co to realita je?
Elfov a draci? Zle kte draci a kte elfov. Budu mluvit za Temn elfy. Drak je sstar rassa moudrch, magii ovldajcch okdlench "esstinovch" (possledn pr jako kdla) plaz ss velkm teritorilnmi ssklony. Draci jssou nadmru neutrln a nelze ss nimi potat v njakch Ssupervlkch mezi dobrem a zlem. Dal rovinou naeho pohledu je jejich vyuit v mench podzemnch konfliktech jako oldn. Possledn asspekt je to, e z draka sse naj vt vessnice z prbhu jednoho mssce a upiny sse dobe ssmuj.

Jak lnek?
Argonantus28.2.2003 (10:34)
Darkelf: Zajdi na hlavn strnku, a uvid.

Jak se d drak najmout jako oldn? To je mon jet chylnj, ne se mnit v lovka!
Argonantus28.2.2003 (10:37)
Darkelf:
Jo, a abych to nezakecal - j bych taky nevidl realitu jako nco tak pln jednoznanho (viz mojich poslednch replik Fandovi).
V jin realit sv existence se docela slun ivm nm, co podle lid, jako je Fanda, vbec neexistuje.
darkelf28.2.2003 (10:50)
argonantus : Jo, peteno. Dobr lnek, ale nic novho pro m!
Draci nenvid lidsskou rassu (pssal jssem u o tom - porn pan atd.), take nen problm ho pemluvit k mal vlen vprav. Temn ssi vezmou to co potebuj a drak ssi zabije pr lid, ssem tam dosstane na podnosse hlavu paladina a jinch vyvrhel, kte mu neusstle ussiluj o ivot pro esst a sslvu!
Taky sse v jin realit ivm docela (ssice n moc odlinm, ale jinm) nse v druh! A kdy doke t jak v jedn, tak v druh realit, pro ne!



Darkelf:
Jo, a abych to nezakecal - j bych taky nevidl realitu jako nco tak pln jednoznanho (viz mojich poslednch replik Fandovi).
V jin realit sv existence se docela slun ivm nm, co podle lid, jako je Fanda, vbec neexistuje.
Wothan28.2.2003 (11:04)
Bu je nco se systmem, nebo tu nkdo zase systematicky mae pspvky...mn vn nebav pst pspvky kter za pr minut zmiz.
Wothan28.2.2003 (11:05)
Be j jsem dement - oni otoili poad pspvk a j se stle dvm dol...no nic, nic nezmizelo jak koukm. Takhle se to skuten bude st lpe.
Fanda28.2.2003 (12:12)
Darkelfe, zd se bti dobr magor. Zan se mi lbit ^_^
Prokoukli jste m, u nem cenu to skrvat - jsem Technokrat ^___^
Jen si nemohu neodpustit upozornit na rize evropsk pohled na draky, kterho jste se dopustili ve svch reakcch a zaslepen opoutte to, jak sv draky vidli nap. an.
Jo a pokud jde o ryby - slyeli jste u o sekrnatkch? Ty mrky dok chvilku opravdu aktivn ltat!
Ten strach primt z plaz jsem u zmioval - nicmn na Flinstouny radji zapomeme, neb tady jde spe o hady (od kterch je jen krek k obrovskm hadm a od nich k obrovskm hadm s kdli chrlch ohe namsto jedu).
J netvrdm, e vysvtlit ptomnost drak v legendch jejich existenc nen mon, j jen upozoruji na to, e jsou i jin vysvtlen, kter exitenci drak nepotebuj a jeliko tito krom stnho podn nijak doloeni nejsou, jsou tato vysvtlen jednodu. Jinak eeno - neexistence drak je hipotza, kter me bt vyvrcena, pedpokldn jejich existence je vra a s tou nic nehne.

Realita? Pro m to, co jsem schopen rozpoznat svmi smysly a pochopit rozumem.

Jo, mt tak as, prochzet vechny diskuse....
Argonantus28.2.2003 (12:14)
Wothane, aby ses v tom bordelu vyznal - na tebe mil mj ouch ve 12.55 vera (nevyaduje reakci),
a bod 2) dnes v 9.50 v debat s Fandou (ono to zaalo u dv, ale je to shrnut). Nechvm na zven.

Hele, on ns pec jenom nkdo sleduje - ve fru o zlepen internetov Pevnosti nkdo skuhral, e mu trv dlouho dojet dolu - a oni ho poslechli!
Argonantus28.2.2003 (12:24)
Fanda: Take se vcemn pipojuje k m policejn vt z 9.50. - s drazem, e ty nm tak velkou potebu, jako j, draky hledat.

Realita - vnmat svmi smysly... cha! To m od Lenina? Nebo od Berkeleye? Tady stojm zcela na stran Darkelfa. S realitou je to troku sloitj; vykazuje celou klu jemnjch odstn. Kdybych se drel jen toho, co vnmm smysly:
- zcela bych vylouil nejen draky, ale i dinosaury a vtinu vyhynulch vor
- nepipustil bych ani na okamik existenci nkterch minulch civilizac
- zcela bych odmtl kvantovou fyziku
- netlachal bych tu s vmi, protoe jsem vs v ivot nevidl
- nedostal bych plat, a umel bych hlady
- byl by ode mne konen pokoj.
Wothan28.2.2003 (12:34)
Hmm, jene stejn musm dol kdy chci reagovat. Ad k Argonautov filosofick rovin, ve Scholastice jsem ponkud plaval...kolega Akvinsk pormine, ale kazil mi kdysi dvno znmky z filofsofie :-) Jinak souhlasm e vci potenciln mon jsou zajmavj, protoe nae zkuenost pi v vli stejn vychz pedevm z reality a i sama sebedivoej pedstavivost relnou zkuenost nenahrad. ekl bych e o tom nco vm. Nicmn stran drak musm dt za pravdu Fandovi a jeho logickmu vvodu - lze vyvrtit nebo potvrdit hypotzu, tko se vyvrac vra a pi v vli stran drak jde skuten bu o hypotzu nebo o vru.
Argonantus28.2.2003 (13:11)
Vem:
Moje vra v draky... nerad bych, aby to bylo pokldno za formu svatho vytren. Pouze v tomto ppad u nevystam s klasickm pstupem Fandovskho charakteru - nen to prokzno, ergo
to nen. Nevm v draky jako se v v Boha vemohouccho - sp hledm draky, protoe mne fascinuj .
Podle mne tu je pli mnoho podivnost, aby tahle verze staila; pvodn

Anonymovu otzku (jaktoe jsou draci vude), jsme zkusili zodpovdt:
1) Protoe je to nhodn sms rznch mt, kter se jen shodou okolnost podobaj, a vytvej iluzi jedin (Fanda)
2) Protoe je to vtvor podvdom, sloen z jakchsi archetyp (Carl Sagan, sten Fanda)
3) Protoe draci v ob historick prost existovali a dochovali se z dob starch (j)
4) Protoe v jin rovin reality draci normln existuj (Darkelf)

Nevm - dn z tch opovd jaksi nevysvtluje vechno... mon je to kombinace...
Wothan28.2.2003 (13:48)
Vra je od slova vit a to samo o sob nutn neevokuje nboenstv nebo dokonce fanatismus - pedstava extatickho vytren z vize draka je skuten dost legran :-) Pesto m, podobn jako vra v Boha (bohy, prodn sly, dmony...ad libidum, dle kultury a chuti) principieln stejn zklady - jej podstata, pedmt vry se patn vyvrac a patn dokazuje. Co mne fascinuje, tak jako tebe draci je sama poteba v nco vit - mm za to e tahle poteba se kvalitativn mn, jin byla poteba pravkho lovce vit v prodn sly, nebo duchy pedk, jin je poteba lid znudnch technokratickou spolenost vit v mty...nebo literrn postavy (elfy?), ale stle to je njak poteba...kde se bere? Pro? Tohle je elementrn filosofick otzka, chce-li - drak u je jen objekt (jako ostatn teba elf v jinm fru).
darkelf28.2.2003 (14:51)
Fanda: No tak dk! Zvada nen na vaem monitoru........
darkelf28.2.2003 (15:12)
Wothan: Vra je podle mho zklad mylen. Nen to nic, co by nemli osstatn tvorov. Je to urit ance k dosshnut uritho cle. Ale tohle sse u eilo v elfech, a dosst sse tam vichni motali. Kdy uki psovi koussek massa, nev ss uritosst, jesstli ho dosstane, ale v, e to masso dosstane a pibhne k vm. Jedn sse tedy o njak reflex? Vpoetn processor z neuron?
Vru v Boha nemu celkov vzato possoudit, nevm co to je (realita 1). v realit dv je to pouze nsstroj ke zven ance k ukojen zkladnch innosst organissmu (vvoji ...nessmrteln due, reinkarnace....,a k rozmnoovn).
Lidssk mozek je propojen mnoha vnitnch ssvt, pota a pamt. Kde sse vra bere, to nikdo nev! Ssnad je pedsstava draka dokonce zakdovan v genetickm kdy, ale neijeme v dob, kdy sse tohle d zjisstit. a proto lze udlat pouhou jednu vc, posstult, Draci exisstuj a bassta! Kdo nev, je kac:-)

Argounaute: To co neexisstuje nelze vyvrtit, to co exisstuje zasse nelze potvrdit. ijeme v pli malm ssvt, abychom mohly nalzt Draky.
Wothan28.2.2003 (15:44)
Postult...dogma...axiom...ano to je takov dern een :-))
Fanda28.2.2003 (18:15)
Ha, j si kal, e jsem tady narazil na filozofy! ^__^
Mohl bych zde pro Agronantovo poten vyloit, jak se daj dinosoui pochopit v m definici ranku reality (znm procesy fosilizace, depositace hornin, morfologick podobnost s jinmi formami atd.), ale k tomu ta diskuse neni. Draci u m, stejn jako elfov, magie apod., nle do e Sn - mon je to tak njak realita, ale ne ta nae a bume rdi za to, e se tam meme vypravit ve svch mylenkch.
Jak to tak sleduji, mon vysvtlen byla poloena a te u zbv jen ekat, jak to dopadne. Co tuhle diskusi zabalit a zaloit novou na tma "Jak m zmtlo pehozen poad pspvk"? ^_^
nojon Debe28.2.2003 (18:47)
darkelf: Tady bych to vidl prv opan. Vra je tm, m disponuj pouze lidsk bytosti ( bytosti citc se bti efly, trpaslky nebo dalmi jist prominou ). Pokud uke psovi kousek masa, instinktivn za nm pjde s automatickm pedpokladem, e ho dostane, tud jde o vrozen reflexy. Dal vc je jestli zvata disponuj tak vrou podobnou t na v Boha, v to, co nsleduje po smrti a dal. Pokud studie v oblasti psychiky zvat ukazuje jinak, moje smla. Jinak definice vra jako "Je to urit ance k dosshnut uritho cle." nevystihuje vru tak docela pesn. Kupkladu vra v n existenci se tomu pomrn vymyk.
J osobn chpu vru v Boha dvojm zpsobem - vm pouze v jeho existenci a tm to pro m kon. Nebo krom jeho existnce vm i v jeho spsu, lsku a to, co mi me nabdnout.

Jet zptn k tomu co ikal Wothan - Co se te nap. Boha i obdobnch vc. Pro siln vc se snadno dokazuj, ovem hor to je s ochotou dan dkazy pijmout. asto to bv tak tak, e lid prost vit nechtj, a se dje, co se dje.

Pro zajmavost - http://www.volny.cz/anaximandros/tem/tema21.html
argonantus28.2.2003 (20:30)
Wothan i Darkelf:
Jo, tohle se mi dost lb; kdysi dvno se tvrdilo, e bohov jsou vynalzni, aby vysvtlili, emu nerozumme; Wothan navrhuje prav opak a j s tm souhlasm. Je poteba nemu vit, aby se lovk je tak neplcal; me to bt nco tak subtilnho, jako jsou elfov a mty; nebo tak proflknutho, jako Bh vemohouc; nebo i tak prostho, e to a ono m njakou cenu (co si museli myslet ti manci, kdy thli do Svat Zem - stailo to, i kdy byl na n Bh moc sloit). Vra je nco sloitjho, ne jen "zpsob dosaen cle", daleko vc to souvis s clem samotnm. V tom m Nojon Debe recht.

nojon Debe: Bh pesahuje tma diskuse, myslm. Strvil jsem nad tm hodiny s mm vcm bratrem; kdy tak si oteveme forum Bh (a probereme tam i Lilith).

Vem: Nesouhlasm s Fandovm nzorem, e draci jsou vysvtlen. Naopak, sotva jsme zaali. Zatm jsme vysvtlili jen sv vnitn postoje vzhledem k nim. Ani jsme jet pln neprobrali postoj kultur k drakm veobecn. A co druhy drak; co ten dra dech; co vnitn drakv ivot; co boj s draky (nebo drak s nmi...?)
Argonantus3.3.2003 (8:20)
Darkelf: Jet k chrlen ohn - zkusil jsem ten gen na psovi, a proplil mi klvesnici... asi to funguje...

Wothan a Darkelf: nicmn mm podezen, e chrlen ohn je docela novodob vymylenost... a e star varianta - stedovk - byl jed, kter njak psob na dlku (mluv se o tom v souvislosti s bazilikem - jedna teorie dokone tvrdila, e ho lze zlikvidovat tak, e se mu nastav zrcadlo, a on otrv sm sebe...)

Ze starch vyobrazen nen chrlen ohn obecn patrno (navc sv. Ji typicky bod draka kopm do tlamy, a ohnm by se vechno zkomplikovalo).
darkelf3.3.2003 (12:22)
Fanda: Wothan by mohl povdat!
darkelf3.3.2003 (12:32)
nojon Debe: ty naivn Humne. Pouze lidi ssi myssl, e jejich vlasstnossti pat pouze jim. Tak jak jednoho dne sskon lsska v popissech enzymatickch drav v metabolissmu, tak jednou sskon i vra! Pot u to nebude to hloup duchovno a vichni Humni budou na sstejn urovni jako abka Kuka! Pokud pssovi uke masso, pjde proto, e "v" (sstejn sslovo je pedpokld, "automatick" ??? jak to jenom me ct. Ale copak kdy v Humn, nepedpokld, e toho jednou dosshne (toho cle). Nebo ssnad lid v v nco jinho. (vra v boha je pouze chuchvalec "prkotin" i ivotnch mouder kolem jedn hlavn mylenky, na kterou nalkali tolik "vrnch", a to nessmrtelnosst....a pi n lovk "automaticky" pedpokld, e nessmteln bude. Kdyby vdl, e je to blbosst, pochybuji z cel ssv due, e by exisstoval Vatikn. Pokud exisstuj Humni, kte od vry nic nepoaduj, pak m unikla podsstatn sst lidsskho chovn!
darkelf3.3.2003 (13:05)
Argonantus: Jak byss chtl rozdlit cle lovka. Vdy je to jenom jedna vc: spch a ve ss tm sspojen! Pokud nkdo jde za clem jinm, bv sspolenosst odssouzen (pssychopati a blzni). I ti v podsstat jdou za ssvm sspchem! Kdybys mohl dosshnout ssvho cle bez odporu okol, nepoteboval byss vru!

Jinak k tvm drakm. Druh je tolik, kolik na ssvt bh barev (alesspo m to tak pipad). Ale ve ssv podsstat je jeden drak jako druh! Sspe sse jedn o sspecializaci na dan biotop!

Ss tm chrlenm jedu bych sse chytl Kobry ernokrk, kter ho chrlit um. Ss ohnm je to pot. Ssice jssem sslyel mnoho teorii (holav kapalina...pluss nco co dv jisskru) a nemysslm ssi, e je to reln. Pedsstava draka kter ssebou thne njak kanisstry benznu m rozessmv (obrazn eeno, kam by tu kapalinu sskldal). Pokud by teda mlo nco hoet, mlo by sse jednat o plyn (navrhoval jssem kysslk, ale ten jssem zavrhl), take teba acetylen ss kysslkem. Pro by nemohl vznikat, dky tajemnm klikm Draho metabolissmu. Kdyby ho drak vydechoval, odpadlo by problm sse zssobovnm! Ledov dech by mohl bt zasse tyto plyny, kter by dky vyssokm tlakm z prudkch sstah v drach plicch by sse mohli zkapalnit a ssnit tak ssvoji teplotu (??). Blesskov dech (u to zn jak pokmoni) bych pirovnal k tenm njakch desstiek na pate nebo mechanissmuss ala paho. Osstatn vdechy draky bych pouze kombinoval z tchto t!

Vnitn dra ivot? Wow, i m by sstran zajmalo, jak uvauje tvor ss vt moudrosst ne Humn!

Jinak kdov co Ssv. Ji probodval kopm.
Fanda3.3.2003 (16:48)
nojon Debe: Kdy mi maminka pipravuje u plotny veei, tak sedm u stolu s automatickm pedpokladem, e ji dostanu... Apropo, velmi pravdpodobn svou vru (vru v Cosi) maj bonobov. A tmto vahy na tma vra konm.

Vem ostatnm drakomilcm bych rd pipomenul, aby se pi pedpokldan rekonstrukci tohoto tvora tak zce nedreli toho, jak jej znaj z vyprvn, neb lidsk tvoivost je velk a teba z nosoroce dokzala vykouzlit jednoroce.
Holav plyny chytajc pi vdechu - nevm, ale radji nezapomnat, e dchac soustava (plce a ta spousta trubiek, co do nich vedou) jsou v podstat vnjm prostedm, jenom obrcenm dovnit ns, take by nm chudk shoel. Ostatn asi jako kdokoli z ns, kdo by se nadchnul istho kyslku...
Wothan3.3.2003 (17:06)
Mno, stran ohe chrlcho draka...tak si taky zaspekuliji. Hoc vzduch (nebo plyn) ne, pokud bych chtl takovho tvora zkonstruovat, nebyl by to plamenomet nebo autogen - ml bych toti problm se zptnm ventilem. Taky kesat jiskru zubem asi nebude to prav oechov. Ale co njak na vzduchu samovzntiteln kapalina, nebo men nkolika jinak samostatn neholavch kapalin? Nejsem bohuel chemik a moje znalosti chemie jsou mn ne bdn, take by se k tomu mohl vyjdit nkdo "od fochu" - chemik, pyrotechnik, terrorista apod. ne? Zajmav je e se v souvislosti s draky a ohnm mluv asto o se...co ovem zase klidn me bt klasick kesansk atribut pekla (a koneckonc kesansk drak je vlastn vtlen bel - viz. apokalypsa sv. Jana).
argonantus3.3.2003 (17:20)
Darkelf (a taky Fanda:)
1) Takto definovan spch je znakem vech tvor, vetn drak, jednoroc a vbec. Evoluce vede k elnosti. Zda to plat i rpo temn elfy, to si nejsem jist. Pro beholdery sp jo. Lid ovem podle mne nkdy v skuten " jen tak", jak tvrd nojon Debe - jejich vra nem s spchem nic spolenho (dokonce je zjevn vede do prseru, a oni to vd).

2) Druhy drak - v mm svt (zhruba pln 3 reality) jsou draci psn dleni podle esti heraldickch barev; drak rov nebo fialov proto nejde. Nicmn nkdy si pod vlivem rznch racionalist (jako Fanda) u nejsem jist, zda nejsou draci mimosystmov. Napklad je pr drak podzemn, kter m krtk drpy tsn za hlavou, pipomnajc krtka, jinak vypad jako had a nelt; a je dost hnusn; a dl zemtesen; nebo drak vodn. Ciruelo na to ml jin nzor (dlil draky na vodn, pozemn, zlat a jet njak ekologick prasrny na Siclii).

3) To chrlen mi pijde jako pklad jaksi fantastick maximalizace (podobn jako historka s jedem); kdy u je drak nejvt a nejdravj, pro by jet nebyl plamenometn; v edestch letech by byl drak jist i radioaktivn...
V kadm ppad si myslm, e jed pedchz ohnstrjn draky; a st je alchymick nedorozumn (viz pln zatek debaty)

4) Bleskov dech?? Co je zas tohle?

5) Vnitn dra ivot vidme trochu podobn; a dost mlhav. Drak je pvodn mimo dobro a zlo. Je jaksi mimo nae starosti; mysl v mnohem delch rozmrech. nen tak zvisl na vcech a technice; vlastn skoro vbec.

6) Svat Ji zabjel draka, to je jednou jist; a vrazil mu kop do tlamy. Myslm, e velk vtina vyobrazern a soch m k jedinmu archetyplnmu obrazu. Jestli to byl skuten drak (a ne symbol neho pln jinho), kdy to pesn bylo a co se vlastn pesn stalo - to je jedno z nejvtch tajemstv
nojon Debe3.3.2003 (17:41)
darkelf: Pokud by zvata mla stejn schopnosti jako lid s nejvt pravdpodobnost by e zvat vypadala zcela odlit ne tak, jak ji znme. Vra samozejm skonit nemus - snad vdy se d najt vc/bytost/idel, v kter d vit. Dle mho vra neme nikdy skonit, pouze zeslbnout. Toho psa bych vidl tak - pes vid maso a nepeml jestli mu ho d nebo ne, zda si s nm jen hraje nebo to mysl vn, prost uvid/uct maso, a tak za nm b. Taky u jde o hran se slovky - to, co jsem ted popsal si zase me pojmenovat, e v, stejn jako cokoli jinho. Ale otzku zvec psychiky bych u nechal pslunm odbornkm, kte se tm zabvaj a asi vd o jde. Ne, nepedpokld, ale douf ,i v to vkld nadji, co je, a se to mon nezd, nco jinho ne, e pedpokld. Nemue oznait vru v Boha a podobn vci za chuchvales prkotin - i kdy pokus o eliminaci tohoto faktu to je dobr - nebot je to prv to, co ns li od zvat. Jinak ta mylenka je pouze nesmrtelnost due, ne fyzickho tla. Jinak samozejm, e ne lovk uv, automaticky o tom peml. Na kolik je to mon a dal. Prv jsi dal pklad vry - pokud by lovk vdl, e nco takov nen, pec V, e to snad mon je. A v tom je krsa vry.
nojon Debe3.3.2003 (17:58)
Fanda: A nkdo zased s jistotou, ale tohle nem s vrou nic spolenho nebo sp mi pijde nevhodn oznaovat slovem vra, anci psa na to, e dostane maso. Vra je rozmanit zleitost. Ale vc nzoru - jedna divina mi povdala, e v v orgasmus.
Argonantus4.3.2003 (9:43)
nojon Debe: ve podstatn je eeno na fru Bh. Strukturujme debatu, ptel; jinak zkomplikujeme ivot ppadnm nov pchozm!
darkelf4.3.2003 (13:48)
Fanda:
Dk za podporu ohledn zvat! Ale pokud jde o moji (nedokonenou teorii draho dechu...ohledn mrazcho) neme zasse uvaovat v jin rovin?! Pro by mli mt osstatn tvorov sstejn vlasstnossti, sstejnou sstrukturu a sstejn chovn jako lovk? (to, e lovk je sstedem vessmru sse assi nezbavm). Plicn epitel draho dchacho sstroj je vysstln bukami, kter jssou chrnn vrsstvou, kter je proti oxidaci ressisstentn a nessnadno tento plyn rozpout!
Argonantus4.3.2003 (14:00)
Darkelf: naprosto souhlasm - lovk rozhodn nen stedem vehomra, nb jedna z jeho celkem neparnch soust (dle nkterch dokonce nedopaten. J bych snad tak daleko neel).

A k tomu chrlen - zanm si myslet, e chrlen ohn se objevilo na scn nkdy v dob okouzlen eckm ohnm... jinak ta kyselina tu klidn mohla bt dv (pokud je mi neutralizovna na pokoce draka... ha, mm t, nevc Fando!!)

Jet mi dlu bleskov dech, Darkelfe (3.3. v 17.20)! A taky klvesnici...
darkelf4.3.2003 (14:01)
Wothan: Zptn ventil bymohla zajisstit hrtanov zklopka! Kessn jisskry o zuby bych ssi nevymysslel ani ve ssnu (i kdy..). Pssal jssem o enzymech, kter by se vzntily pi urit koncentraci kysslku. Acytylen je tam jenom proto, aby nco mohlo oxidovat (bez nj byla moje prvn teorie, ale jakssi tohle posstrdala).
U tch kapalin nasstv otzka, za jak dlouho by sse drak vyerpal (zssoby kapalin nejssou nekonen a hlavn by kad mussela vznikat jinou cesstou). To by znamenalo, e by drak ml mt dva orgny, z kterch by tyto holav ltky zsskval (a to ze ssuroviny, kter je na nai planet nejdosstupnj - vzduch)! V tom sspov ta moje (kysslk tam je a acetylen by sse dal vyrobit z CO2). A na tom kysslku to prosst sstojm. Ale mon to bude i povsstn dra magie!
(jinak pokud chce nzor nkoho od fochu.....4 roky stedn chemrna a zatm necel dva roky Biochemie na vejce)! Jiank ss tm pyrotechnikem bych sse klidn u tebe podval do zrcadla, e?
Ss tou ssrou mme na tuhle vc sstejn nzor!
darkelf4.3.2003 (14:03)
K tob jssem sse jet nedosstal, zasse ssi pem mezi prssty!
darkelf4.3.2003 (14:14)
Argonantus Vudyptomn:

1) Tak possledn o ve a pak to pu k bohovi! Ty lidi, co sse dky bohovi dosstali do prsseru to brali jako vhru ssvho j (a o tch jssem pssal jako o blznech a pssychopatech. Ber to jako chybu z hranic normlu lidsstv!)

2) Pouze est heraldickch barev? A to kter? Jinak vm v Krtkovitho draka (jesstli o tom Fanda pssal, tak mme sstejn nzor). Ale u m sse nejedn o draka prodnho z organick hmoty, ale o draka kamennho, diamantovho. Je to ten tvor, dky jemu je podzem tak rozsshl a sspletit! Co ssi myssl o kovovch dracch (je to pouze dky lessku jejich upin nebo doopravdy obssahuj vzcn kovy)?

3) No mj nzor zn. Radioaktivita by byla pro draka, kter b sse nezkldal ze sstabilnch izotop, ponkud ossudn!

4) O nm jssem sslyel, e je to zpssob toku modrch drak. Originln a prod nejbli (i kdy v pozoruhodnm proveden). Mon lo o to pouze rozdlit bl a modr draky!

5) No njak tak! A por lidi:-)

6) Tak jo, tak ho assi zabil! Tak pat k tm, co sse zaslouili o jeho vymizen! Sshasshek jeden!
darkelf4.3.2003 (14:16)
nojon Debe: Odpovd nalezne u boha! (To zn dobe)
Argonantus4.3.2003 (14:38)
Darkelf neobyejn:
U jen k tomu, co zbv:

2) est heraldickch barev jsou erven, modr, ern a zelen; a dva kovy, stbro a zlato (vindlovan lutou a blou). Tak platilo na potku, okolo roku 1150, kdy si to nkdo dost chytr vymyslel - ve ostatn jsou novodob prasrny (ponaje hnusy renesannmi).

U v souvislosti s tm mne taky napadlo, jak je to s tmi kovy v drakovi. A tak s diamanty. Krystaly dvaj jisou stabilitu... a lovk je pln rznch kov, napklad eleza... v plnu 2 tomu dvm plnou zelenou, v plnu 1 to me bt sten pravda (kov, zamchan do ehosi jinho; zven obsah kovu v upinch). Nevm; chemik nejsem.

4) Bleskov - modr drak mus bt elektrifikovn. Originln npad; dodej prameny, kdo to vymyslel; v prod elektrick zvata prost existuj ( i Fandologicky, v plnu 1a). Mon dsledky jsou ohromujc (pro mne jako pro mga - amatra).

6) je to jet sloitj - myslm, e v Plnu 1 je Ji (nebo jak se jmenoval) JEDIN ppad, kdo draka spn zabil, a vem ostatnm to od t doby vrt v hlav. Jak k tomu dolo - zhada!
Fanda4.3.2003 (19:14)
Jen poznamenm, e elektrizujc zv je vzna na vodu - tedy i elekrizujc drak by musel bt vodn - on toti vzduch tak njak patn vede....
Wothan4.3.2003 (20:24)
A nebude probjet?
Argonantus5.3.2003 (8:42)
Wothan a Fanda: To je fakt - elektrick zvata (tum sumec, ho a rejnok uritch druh) jsou skuten vodn; nikdy mne nenapadlo, zda probjej, kdy neto; tohle by vysvtlil asi lpe nkdo z prodovdn vzdlanjch, ne j. Na vzduchu probj jist mn, ne ve vod; a elektrick je prv proto, e me probjet...
Pokud jsem dval pozor, Darkelf tak mluvil o draku modrm, o kterm se tak njak veobecn pedpokld, e je vodn...

Vichni: musm uznat,e spousta vc ohledn drach dech, kter tu zaznly, mne nikdy nenapadly. Dech jedovat nebo kyselinov (mon technicky lpe - jedovat i kysel slina) - jsou docela pochopiteln, u s ohledem na tu plivajc kobru; s tm ohnm mm stle pote; elektriku bych bral (souhlasm s Fandou, e sp ve vod - vboj ve vzduchu, kter za nco stoj, je asi problm); a te to mrazen, kter slbil Darkelf... bacha na nj, je to chemik...
Fanda5.3.2003 (12:15)
Ad elektina: Ono se jedn bu o pozmnnou svalovou, nebo nervovou tk, take je do kontrolovan a tum, e pi vtm vboji se mus i "dobjet", ale tm si moc jist nejsem. Dost tchle potvrek to pouv ke komunikaci a k orientaci - ono toho toti ve vodch, kde ij nap. ti pahoi toho doopravdy moc vidt nen - konkrtn tito produkuj vlastn 3 druhy pole - jednm se orientuj, 2. komunikuj mezi sebou, no a obas daj rnu, chtj-li nco omrit - nkde jsem etl, e snad a 6000 V, nicmn na Ampry to je slab, take rna sama se d rozchodit... toti rozplavat.
darkelf5.3.2003 (16:25)
Argonantuss:

vera jssem ssi vythl draky vech barev z materil, kter mm sstaen z net! A jejich teda poehnan! Nepodle barev, ale i podle odsstn. A tch rznch vciek, co jim vypadv z huby (nkte pr zvrac lvu:-), jin maj vechny druhy od kysseliny po ohe).
Kupodivu vichni povauj modrho draka za tvora ijcho na poutch (urit je tam hodn nenpadn!), ale pessunout ho do vody by nebylo vbec marn! Jinak podobnou obranu m i Bronzov drak, tentokrte velk milovnk vody. Ssysstm by mohl fungovat jak to pe Fanda!

Kovov less nemuss mt jenom kovov ltka. tady by toti (pokud by to byli kovov upiny) nasstal problm, kde by tento drak kov zsskval (jmenovit zlat draci). Protoe druhou metodou by byla jadern ssyntza, ale radioaktivn draci? Zkussm to nkdy najt.

Krysstalov draci jssou podle m jet zajimavj ne kovov. Nkte tvrd (oividn ovlivnn Hobitem), e kdy drak le na ssv hromdce drahokam a ty potom, jak rosste, zarsstaj do jeho ke. Sice tady u nen problm ssuroviny zsskat, teba sse potom vyluuj jako odpadn ltka, kter na jejich ki krysstalizuje!

(te m napadlo, rosstou draci a do ssv ssmrti, nebo sse jejich rsst zasstav........................a rosstou teplokrevn ivoichov taky do ssv ssmrti jako sstudenokrevn, nebo ne)

Ss tm mrazcm dechem ssi jet bude musset pokat, mm v tom hodn nejassnosst (ale assi to bude zkapalnn plyn ze vzduchu)
argonantus5.3.2003 (18:02)
Darkelf a Fanda:
rochnm se potenm z vaich objev...
Vrtm-li se k ji skoro uzaven zkladn otzce existence drak (28.2. ve 13.11),
pak obraz manka, zasaenho elektrickou potvorou, kdy vlezl do vody, je opt tak asn, e vysvtluje urit st dra zhady (nco jako ta kostra sauropoda). A pi tom to vypadalo s tmi blesky pvodn jako ptkovina... Darkelfe, moc prosm - kde jsi na to piel? Co je nejstar pramen bleskometnch drak?

Samozejm, nikde nen eeno, e by draci vodn musili nutn ltat; dokonce i bez ohn se obejdou. To je nznak Fandovy vahy o vce potvorch v zkladech cel dra historie (to je zcela jasn v ppad krokodl - nap. brno - a had).
Nicmn, stle to ani v nejmenm nevyvrac mj dohad o ltajcch dracch (pokud je to ve vod nebo je to velk kostra, nen tu pradn dvod, aby to ltalo).Ale u s tm prozatm dm pokoj.

Ty krystaly na povrchu vypadaj zajmav; ona takov pitom sl to doke taky...
darkelf6.3.2003 (9:55)
Argonantus: modrho draka a blesskov dech ssem nael v AD&D (second edition), ale nemu ti ct urit jesstli to bylo poprv. Mon v Dragonlance byli mod draci, ale jakej mli dech, ert v?
argonantus6.3.2003 (10:19)
Darkelf: Dky. Nco starho by nebylo? (nco jako Wothan 25.2. v 11.25, bl힚 podrobnosti nekm, neb ert a Lad nikdy nesp... mimochodem, zan mne to docela bavit...)
darkelf6.3.2003 (10:33)
Argonantus: Wothan m k hisstorii trochu hodn bl ne j. Mrknu sse na netu, e?
darkelf6.3.2003 (12:24)
Argonantus: http://www.igolddragon.com (doufm, e t pot, alesspo ten odkaz)
argonantus6.3.2003 (12:47)
Krsn odkaz, dky za vechny drakovdce, kte na tohle frum pijdou.
Mimochodem, ten Ciruelo a Montse Saint, co tam funguj - existuje od nich moc pkn kniha o dracch v estin (prkrt jsem to tady citoval).
darkelf6.3.2003 (12:52)
Argonantus: Tentokrt jssou blessky u lutch drak (poutnch)
darkelf6.3.2003 (12:54)
omyl i u modrch
darkelf6.3.2003 (13:03)
Argonantus: zvlt http://www.colba.net/%7Etempest1/From_tail_to_snout/
argonantus6.3.2003 (13:20)
Taky hezk lnek - trochu v duchu na diskuse... tak njak to asi mlo vypadat v Pevnosti . 2.
darkelf7.3.2003 (13:46)
Argonantus: Vid, podklad m dosst, me napssat njak lnek o dracch a j sse zasse vrtm ke ssvm
argonantus7.3.2003 (13:55)
Darkelf: O lncch se prv jedn... tv domovsk doup jsou "elfov"?
Ml jsem pocit, e jsi docela kosmopolita - i ve srovnn se mnou...
darkelf7.3.2003 (14:06)
Argonantus:
Jssem, ale pracuji na webu o temnch a njak to zadrhv z nedosstatku assu, ssnad i prosstoru! A jet k tomu eit drakologii, kter je podsstatn zajmavj, ale j chci prvn najt ssvoje koeny,potom mohu hledat jin! (to neznamen, e sse Drak vzdvm, ale j u doma pekldm jedna radosst)
argonantus7.3.2003 (14:12)
Darkelf:
Vdy se to netlue. Jet neumrme. Vm, e svtlo svta uvid tv pojednn o dracch, i o temnch elfech...

A mimochodem, co jsi s tm zaal, ti beholdei mi njak uvzli v hlav. Nco na nich je. Mon o nich tak nco zjistm...

Pedpokldm, e nar na frum "Dost bylo Pna prsten", kde jsme se vzjemn dernicky povzbuzovali k staten prci pro Pevnost...
darkelf7.3.2003 (14:17)
Argonantus:
Proto jssem nechtl sstrait, abychom neumeli! Ale mysslm ssi, e ty by jssi ml pojednat o drocch, protoe tv dui jssou nejbli!
Beholdei, tajemn, krut, bez boha...Co to znamen "V oku Beholdera?"..

Jo, tam jssem sse dval: chtl jssem posslat pr obrzk do galerie, ale nevm jak.
argonantus7.3.2003 (14:22)
Darkelf:
U t zase pestvm sthat.
Ale tohle je pro obecn blaho; na zmnnm fru je mail Pavla Divie - Divouse, ktermu jsem napsal... mm rovn adu technickch problm - klidn bych pro Pevnost nco udlal, ale nevm jak... tak jsem se ho zeptal mailem... udlej to taky - teba to bude fungovat (kdy nape redakci, je to, jako bys to hodil do studny)
darkelf7.3.2003 (14:24)
Argonantus: te je otzkou jesstli sse to z t sstudny vrt? Ale assm....
Wothan7.3.2003 (14:30)
Nevm co je Beholder, take netum co by mlo znamenat to ren...
darkelf7.3.2003 (14:52)
Wothan: Tvor S jednm centrlnm velkm okem a nekolika malmi oky ne chapadlech rozmsstnch na kulovitm ssvalnatm tle (takov vceok chobotnice).
Wothan7.3.2003 (14:58)
A to vzniklo jak? Z mythologie? beletrie?
darkelf7.3.2003 (15:02)
O tom nemm potuchy! Jesstli to m vbec njak sstar zklad, mon je to pouze novodob vc.
argonantus7.3.2003 (15:41)
Wothan a Darkelf:
J teda nevm, ale beholder mne prkrt vokliv sejmul v Might and Magic 7... a taky jsem z nj prkrt zelel... bylo to v mstech jmnem Clankerova laborato a Hromov hora...
pak jsem na to zapomnl, a to na mne zase Darkelf tady vythl... nevm, co je beholder, ale asi je to pkn nadlen...
existuje njak hra Eye of the Beholder... nebo je to kniha? Vc o jejich mytologii nevm.

Nicmn znm Cthulhu od Lovecrafta... a to je taky vten potvora. Take njak tradice nebezpench chobotnic asi je; v kadm ppad to m jakousi magickou slu tak.
argonantus9.3.2003 (15:25)
Vichni:
Jet jednou k m oblben vnitn strnce drak - co se vm vybav, kdy se ekne drak? Co ctte? Co vnmte?
Frelin9.3.2003 (22:25)
argonantus: M se vybav moudrost a majesttnost a umn magie... A pak to e sou darci pkn parchanti a erou princezny... :))))) (To v pohdka o Bajajovi je moje oblben) :))))))))))
darkelf10.3.2003 (11:46)
Argonantus: No tyhle beholdei (v MM7) jet nepedsstavuj plnou sslu jejich druhu. (jsou vt, tlusst a jejich magie je hroziv)
Co je to Cthulhhu? Dal Behold....?
darkelf10.3.2003 (11:48)
Frelin: JAko velk Trpasslk by jssi ml vdt, e draci princezny nejed proto, e jim chutn, ale aby ssi plkali mnohem massitj hrdiny!
M sse pod pojmem drak vybavuje Moudrosst, Sst, Volnosst, Neutralita, Sstrach i tsst a nokonec obrovssk koncentrace magie.
argonantus10.3.2003 (11:53)
Darkelf:
erbovn straidlo H.P.Lovecrafta, jednoho z velmistr hororu a souasnka Tolkiena. Vele doporuuji Lovecraftovy povdky (vyly tum asi troje).

Cthulhu piel z hvzd kdysi dvno... a vytvoil msto R lyeh, kter je pln podivn geometrie, ohromnch nazelenalch kvdr... a m tvar postavy s osmi rameny... je mli vysok... a ty oi! Ty planouc oi!!

I Cthullhu fthagn! Ve mst Rlyeh le mrtv snc Cthulhu!

(jet se neboj?)
argonantus10.3.2003 (11:58)
Darkelf a Frelin:
k t asociaci... je to hrozn zvltn, ale vtin lid se vybavuj podobn vci... j vidm draky tak tak njak - ohromn neutrln sla, kter si dl, co chce... a ta magie je tam urit taky (prav magie - dn RPG modr blesky!!)... asi jako Niagarsk vodopdy... nebo jako manelka...
darkelf10.3.2003 (12:00)
Darkelf:
Zkladn tvar beholdera: ossm ramen, ossm o a to jedno uprssted, tak krut a krvelan, ale i pln moudrossti a pochopen! Beholdei taky pili z jinho ssvta k nm, ale nechtli tu zsstat, ale neasstnou nhodou jim nic nezbylo, a tak sse z nich sstali paranoidn ssamoti. Ssnad Cthullhu je jejich ztracen bh a ssn o nvratu ssvch dt.

Ne nebojm sse ho, je ssm a je mi ho lto! A to jssem Drow.
darkelf10.3.2003 (12:21)
Argonantus: Teba jssou to sstrci prody, sschopny niit jej chyby!
Niagarssk vodopdy, mno fuj, pln komeren ze pinavou vodou, to ssnad ne?! (manelku namm a tak nevm!
darkelf10.3.2003 (12:34)
Argonantus:J j to napssla ssob, jak jssem ssobeck. Tak co, dolo ti nco z redakce?
argonantus10.3.2003 (12:48)
Darkelf znovu pi chuti:
1) Podobnost beholdera a Cthulhu je m dl tm zajmavj... ty jsi nco etl, co j ne - co je to? Moje zkuenost s beholdery je jen MM7 a tak HoMaM, ale tam jsou jet mn dramatit...

2) Niagarsk vodopdy (stejn jako vechny ostatn, pokud ti lpe sed teba Viktoriiny a Salto Angel, ostatn vt) tu byly dvno pedtm, ne komerce, Ameriani vetn Indin...

3) Manelka je nco, co stoj fakt zato (jak ti potvrd kad, kdo se do neho podobnho pustil) - asi jako drak, beholder nebo Bh; kdy se to zvrtne, skon to podobn...

4) Odpovdl mi Divous, velmi podrobn a ptelsky; te s jeho nvodem tom pmo na Pevnost!
darkelf10.3.2003 (12:57)
Argonantus opt vdyzasstihnuteln:

1) J je znm taky z Zapomenutch zem, m domoviny (Forgotten Realmss)
a tam jssou u peen a vaen. Je pravdou, e nemaj opravdovho boha a nkdy ssi na nj hraj (Baldurss Gate II - Kult nevidoucho Oka). Ale nic o nich bliho Humni, kte pou o naem ssvt nev. A le mi, Temn, kte ijeme jako ssoussedi ss nimi vpodzem, znme jejich ssiln a sslab sstrnky. (V MM ssrich a v Homamech by byl ssilou na rovni ervenho draka)

2) Niagarssk vodopdy jssou taky prudk a nesspoutan, ale za podmnky znien ssvho okol. Santo Angel by k pirovnn k Drakm byl asstnj.

3) Ale j zatm nevm o co jde, a dky Beholderm a Drakm za to!

4) Peji dobr tok......a napssal ti nco o vkldn obrzk?
argonantus10.3.2003 (13:03)
Darkelf:
3) Rozhodn nedkuj, protoe kdy se to vyvede, je to stejn skvl, jako draci, Bh a beholder... nebo jet mnohem lep.

4) S obrzky mne moc nepotil... navrhhuje naskenovat jako JPEG ve vym rozlien; ppadn, e on si to kresl sm...
darkelf10.3.2003 (13:06)
Argonantus:
A kdy to mm nasskenovan (lpe eeno nakressln na PC) a i ve velkm rozlien, jak to tam mm dosstat?

Ty ssnad u jssi enat? Proboha!
argonantus10.3.2003 (13:11)
1) Pravdpodobn pipoj vznikl JPEG patvar jako soubor k mailu, a nech je, a se s tm njak utkaj... pokud to chce vydat v paprov verzi. Na internetovou se mne neptej, zdej samoobsluhu jsem jet nerozchodil (a taky tu ode mne jet nikde nic nevis...)

2) 16 let. J t varoval. Jsem zejm nejstar ze vech tady (v Plnu 1, v tch ostatnch jsem ovem jet daleko star. Mladku mi kal naposledy krl Vladislav, a to jet zjevn omylem...)
Wothan10.3.2003 (13:15)
Tak star nejsem ani j :-)
darkelf10.3.2003 (13:18)
argonantus:

OK!!!

1) No j bych poteboval internetovou ssamoobssluhu, ale assi tam budu musset napssat, e?!

2) A nebol to! Nai jssou sspolu 21 let a sskpe to vuhovudy vude, take mi dti trpme, ale jssme dosst velic, abych rozssvali zkzu v POdtemnu:-))) No mlo m to napadnout, tolik vdomosst a moudrossti. Klanim sse ped tebou, sstare, protoe tvj obraz m nepedil ani o jeden rok. Pohybuj sse v iluzch tohoto ssvta, zejm! (To nee, mj mozek to pochopil hned, ale moje j ss tm m problmy)! (No punkov disskuze to opravdu nen!)
Jak to, e tak dlouho zsstv v tv dui Dra magie, j mysslel, e v tak technickm ssvt to ani nelze?
argonantus10.3.2003 (13:19)
Wothan:
To j dvno vm, chlape... ale jinak mi, Wothane, dlu jet tu asociaci.
darkelf10.3.2003 (13:25)
Wothan: Take sse tu pu ss dvojnssobnou moudrosst?!
argonantus10.3.2003 (13:31)
Darkelf:
protoe svt je mnohem barevnj a zajmavj, jak u jsem staecky ekl (take se nudn opakuji...)

Pokud ty ses mohl vyvinout od ministranta v temnho elfa, pak dovol jinm, aby se vyvinuli z fandologickho materialisty pes cynicky klebnho Darkelfa k trochu potrhlmu mgovi, kter nakonec shledal, e s realitou je to vechno trochu jinak, ne mu tvrdili... je dost velk rozdl mezi spojenm jsem pesvden a pesvdil jsem se...

vtip je v tom, e magie prost existuje, vichni to mlky uznvaj a pracuj s tm (vce i mn dovedn), ale z jakchsi dvod (stud ped Fandokraty?) se to styd ct nahlas...
argonantus10.3.2003 (13:38)
nebo s dvojnsobnou senilitou...
darkelf10.3.2003 (13:39)
Argonantus:
Ano, tento dvod chpu, ale neznm mnoho lid (prakticky dnho, a to znm irokou sspolenosst od temnoty po ssvtlo), kter by v tomhle vydrela. Doufm, e i m tohle vydr, doufm, e nesskonim jako dov Humn bez fantassie a idel!

Mj vvin byl mnohem ssloitj ne by sse zdl (jenom obyejn pechod z dobra na zlo)....vyzkouel jssme ssi prakticky vechno a zsstvm u toho, co je mi ssrdci nejbli a proto ti nechci brt tvj ssen, i m sse lb a je jednm z nekrssnjch a endorfinem nejnabitj vc, co znm!

Magie je, nen pochyb, kdy me exisstovat jedenct rozmr vessmru, pro by nemohla exisstovat magie!
argonantus10.3.2003 (13:49)
Darkelf:
Ostatn, nzornou ukzkou praktick magie je tvoje pekvapen ped chvl...
i to, e ns dra kouzlo lk k tomu, abychom nad nimi bdali (i kdy trochu vindlujeme - odboujeme jinam - ale i to pat k magii)

Vtip magie je v tom, e ji me stokrt prohlsit za nevdeckou ptkovinu; e nelze pln pochopit, jak funguje; ale potom se stejn stane bu jej obt, anebo se o ni bude pokouet...
... a to zase staecky odbouji (neschopnost udret mylenku - J. Cimrman)
darkelf10.3.2003 (13:55)
Argonantus: Moje pekvapen nebylo magick (alesspo co ssi pod tm pedsstavuji), nebojm sse moudrch, ale mm takov blb pocit, e zsskvm ponkud vt odsstup. Pouovat sstar sse peci nehod, i kdy.....
Draci m lkaj, to nepoprm, ale tak m lkaj i jen vci! Nejssem zatm ve vku, kdy sse fixuji na jednu vc, ssvt je pro m prosstorov obraz, a proto ssnad lpe chpu chaoss... (taky odbouju, co).
To je vtiv veho, co neumme dokzat!
argonantus10.3.2003 (14:08)
darkelf:
J nevm, jestli se to hod, nebo ne; ijeme v dob, kdy je inzerovan moudrost starc pomrn na prd. Zkuenost nen posvtn krva; spousta lid nco dl dvacet let, a pi tom dvacet let pln blb.
Navc zkuenost m smysl pouze v njakm konkrtnm kontextu; jak u jsem inzeroval, v ppad Wothanova ermovn projevuji naden dtte, protoe o tom vm pesn stejn. V ppad drak je nae zkuenost veobecn vetch; nevidm dvod, pro bych se nenechal vzdlat od nkoho, kdo vystudoval (narozdl ode mne) nco prodovdnho. Jak km - s tou elektrikou napklad a s kostrou sauropoda se mi otevely oi (v ivot mne to nenapadlo).
Krom toho, nevm, jestli sis toho Wothane viml, ale v jistm smyslu zhruba od dvaceti let systematicky blbneme. Logick problmy u nikdy nebudeme eit tak brilantn (ani kosmologick). Jedin nae vhoda je, e jsme toho snad vc peetli (pokud jsme etli a pokud to umme).
Mimochodem, co se te problm vedle, tedy Boha a kosmologie, podle id se zatek Genesis vbec nem st ped tyictkou - a o nespluju ani j...
Jinak- asi se nikdo z ns nefixuje na jedinou ideu (taky by to byla dost otrava). Na druh stran - zde jsou draci; tud ns k tomu fixuje neexistujc procedura... a magie pat jinam...
darkelf10.3.2003 (14:18)
Argonantus:
Tahle doba je vznan dravosst a nessmysslnm nakldnm energie do toho, co nss sstejn jednou ssraz do kolen a pak pochopme, e ve sst sse nkter vci u eit nedaj!
Ale j vku nerozumm, jssem pli mlad i na to, e hrozn zrm, kdy sse nkdo z mch znmch ve dvaceti vd! Ale i zkuenosst z toho, e je to blb, dv poznatky mladm!

Moudrosst nen inteligence. Moudrosst je o tom, jak dokeme uplatnit ssvoje znalossti.


Zde jssou Draci
argonantus10.3.2003 (14:29)
Darkelf:

Nae doba je dost zbsil, ale to mne nepivd k pesvden, e by njak jin byla mn zbsil... vtina lid moc nepeml (a pr jich peml a moc) - to bylo, jest a asi i bude.
Ve dvaceti brzo? Ani s tm si nejsem jist... enil jsem se ve 22 (to bude tak njak okolo tvho vku, ne?), a u ve dvaceti to bylo jasn rozhodnut...
Kdo tvrd, e rozum vku, je blzen.

Tady jsou draci.
Wothane, co se ti vybav, kdy se ekne drak? Mythologick bytost, nebo nco jinho?
darkelf10.3.2003 (14:31)
Wothan: NO! Co ty a Draci?
darkelf10.3.2003 (14:37)
Nic, tak sse mjte Pardi, j mussm jt na ssemin (kmoka mi nedonesla bbovku, b)
nojon Debe10.3.2003 (15:09)
argonantus: Kdy se tu o tom u mluvilo. Neposlal by si mi ty podrobn instrukce od Divouse na mail poor_hero@centrum.cz. Budu ti vdn.
argonantus11.3.2003 (8:34)

Nojon Debe: kol splnn, doufm.

Wothan: Co ty a draci - kol trv

Darkelf: K emu takov temn mrcha potebuje bbovku? A nepeslechl jsem se, kdy jsem zahldl nco jako ... city?
Wothan11.3.2003 (8:59)
Jste na mn zbyten rychl :-) No v prvnm plnu se mi vybav njak ble neidentifikovateln jetr - spe ale zve ne co jinho. Je to zvltn, protoe mythologie je obvykle (ovem tak ne vdy) povauje za tvory inteligentn nebo jen za jednu z podob jinch bytost (viz. teba Ffnir). A pak samozejm mythologick bytost - zase spe ale v sekundrn aplikaci - ve smyslu historickch standart, znak apod.
argonantus11.3.2003 (11:14)
Frelin,Wothan, Darkelf a vichni v pokusu s asociac:

Je nasnad, e idea draka je v naich myslch zjevn zasaena tm, co do sebe cpeme nejastji a s nejvtm nadenm; u Wothana jsou vraznj ty barevn korouhve, u Frelina Bajaja, u Darkelfa a u mne lze vysledovat i RPG hry, a paprov, i potaov... pak je tam nkde urit Tolkien; a jspousta dalch oblbench knek...

zajmav mi na tom experimentu pijde urit setrvalost tchto asociac; nejen, e se sob dost podobaj (ten neurit plaz, kter se postupn konkretizuje, je vborn; tak njak to je, jen mne to nenapadlo tak ci); jakoby krouily kolem njakho stedu, dreny mytologickou gravitac (to jsem se zas rozkecal)...

Zvl᚝ divn je to, jak je ta idea vytrval i v ase. Kdy odeteme zjevn novodob nnosy (vt draz na magii a ohostroje, i kdy i tohle v tom zrodku nkde vz), to, co zbyde, se nijak moc neli od toho, co by si pomyslel njak vzdlanec okolo roku 1200...
darkelf11.3.2003 (13:04)
Dnesska tady vbec nejssem, tak
Argonantus: U ssem sse lek, e j k temmn mrcha...bych ssi t assi napssal na ssvj jdelnek. Ale dolo mi, e je to narka na moji rassu! A lb sse mi! Jssem temn mrcha, zn to tak hezky a proradn! Bbovky: jako jdlo ssamozejm, kdy mi nkdo nabdne nepohrdnu (Dvej, dokud beru:-)). To byl jenom pomjiv a ironick ssmch, ss city to nic sspoleno nemlo, i kdy by sse mj pdl bbovek omezil, radosst bych z toho neml!
Ten druh vraz pro bbovky jako mncenn druhy, ty nepotebuj, je to pouze krmen pro pavouky!
No u m lsska k drakm, dalo by sse to tak nazvat, nevznikla nejen z RPG, ale i z velkmu obdivu k dinossaurm, kter vak zanikl v ranm vku!
Ale podobu draka m dalo fantassy! (Sspe u Tolkiena m mrzelo, e tam tak mlo o dracch a mlasskal u Dragolance, tam jich je vc ne dosst!)

Draky bych povaoval za velmi dokonalou pedsstavu o tch, kte tu byli ped nmi (doloenou dinossau kosst), je docela hezky vidt, e i v t dob dokzali lid ssi v hlav dotvoit jejich tvar, kter sse u moc neliil od tvar, kter uznvme dness.

Wothan: mussme piznat, e nejenlovk je iv inteligenc:-)
argonantus11.3.2003 (13:25)
Darkelf neptomn:
nechtl jsem pst, kdy tu nejse... ale njak mne to penutilo (?); ostatn, j tu nebudu nkolik dn (ztra naposled)

Temn mrcha (podotkm Moravsk) patilo samozejm tob; nic jinho bych se neodvil (sic mne stihne tok Temnch, beholder a velieho dalho); a byl to obdivn vraz naivnho dobrka...

Ale ti dinosaui... to je vlastn tak dost dleit; neml nhodou na oiven drakologie tak vliv Jursk park a to tetn okolo?
U mne draci hluboce pedchzeli dinosaurm; zaali nkde u Bajaji, podobn jako u Frelina, pokraovali pes heraldiku jako u Wothana skoro souasn pes Hobita... a pak nakonec piel Turin Turambar s Glaurungem, a bylo rozhodnuto... tenhle asi nejsilnj zsah vedl k povdce, kde vznikl prv i Argonantus (pokud t to zajm, polu)
darkelf11.3.2003 (13:45)
Argonantus neodbytn:
(jak ztran napossled? Jako pln, u ume, i co?) (aby jssi nenamtal na moje city)....jinak jssem doetl ssthujc odkazy na Bohovi, wow?

Temn mrcha sse mi lb a ssnad sse i ujme, i kdy jssem ve zkrze proran dobrotou k lidem, kter mm rd, ale ta druh sstrnka m tolik lk k tm, kter nenvidm?

M neovlivnil Jurssk park, m ovlivnil Zdenk Burian a jeho obrzky a poprohldnut prvnho mitologickho draky bylo rozhodnuto! Jurssk park nebyl a zass tak dobr, aby nco obnovoval, byli tu i sstar filmy, na kter sse podvm radi, ne an tu patlaninu ss genama (kterch mm nkdy pln zuby)
Jisst, e jssou draci sstar, o tom dn, dinossaui je jenom sslep vvojov linie pedurena k vvoji ptk :-) to nemysslm vn( ale kdy ssi vezmeme ru lovka a ru brontossaur, zpodivem jet toho budem moc co dohnt!
Wothan11.3.2003 (14:11)
No nkte jsou pkn ptci u te :-)
darkelf11.3.2003 (14:13)
Wothan: No nevm jak to myssl?

Argonantuss: poli mi tu povdku, jesstli me, rd ssi ji petu a mj mail (kter sse tu nikdy neuke, protoe co den to jinej pota)...darkelf@mail.muni.cz
Wothan11.3.2003 (15:44)
Parafrzuji tvj vrok o tom e dynosaui byli slepou vtv urenou k vvoji ptk nae jsi porovnal dynosaury s lovkem....ergo zbytek je u jen logika :-)
Wothan11.3.2003 (15:48)
pardon...dinosaury
Fanda11.3.2003 (22:03)
Njak se vm ta diskuse rozbedv...
A co mte kdo proti genm - kdyby Jursk park natoili ped 50 lety, urit by je njak radioaktivn ozili (a kdy si tak vzpomenu na Godzilu....)
argonantus12.3.2003 (9:01)
Re dinosaui:

Jo, jsme tu trochu off topic; urit souhlasm s Fandou, e kad doba m sv vkiky (dokonce jsme u na stejnm principu konstruovali radioaktivnho draka); nicmn Crichtonova kniha je v zsad naprosto vten (spolu s Koul asi jeho nejlep, pak u se sp opakoval); hlavn mylenky si nikdo moc neviml, a vem z toho uvzli v hlav hlavn njak genov patlaniny.. a zbytek je prost dra kouzlo.

Tm se dostvm zpt na n Rhodos. Archetypln scny s hrozbou sern, neho velice staroitnho a mlem zapomenutho, k drakm urit pat... myslm, e neinformovan divk (filmu) si pamatuje hlavn na tyranosaura s dpem... a snad ty velociraptory... Spielberg si vypjoval urit ze svch vlastnch elist (ty jsou zcela a pln o tomhle), ale je tak mon, e ten tyranosaurus vznikl zsti z njak pohdky, kter mu uvzla v hlav...
... napklad, pamatujete, jak dun zem, kdy se tyranosaurus bl? Mn se to velice lbilo; v pozad ale je njak mtus, protoe technicky je to blbost...
darkelf12.3.2003 (13:36)
Argonantus:
Dky za povdku (v prbhu vkendu ssi ji petu, sslibuji)
Omlovm sse, e je mi z gen na ..., ale vy sse tohle nemusste uit.
Archetyp draka? To je dobr otzka? Jak vypadal prvn drak (n had, n jetrka?)
argonantus12.3.2003 (13:45)
Darkelf:
jsi pesycen genetikou, jako jsme pecpni Pnem prsten, a jako jsme kdysi leli nad radioaktivitou...
archetypem jsem myslel nikoli draka (to bychom se vrtili nkam na zatek debaty), ale archetyp sern...

nect zvltn psobivost toho, e t prost njak potvora slupne, zblajzne, zbat? Kdysi dvno se lidem takov vci stvaly... od dob vyvradn medvd v echch se to neme stt nainci skoro ani teoreticky (j vm, kdy uprchne lev ze zoo a kdy pojedu na Floridu k moi...)
pesto je sern msi fascinujc a psobiv i dnes... take mon to souvis i s Jonem a velrybou (pro by jinak tahle epizoda byla takov trhk? m jinm zastiuje Jon deset dalch prorok okolo?)
darkelf12.3.2003 (13:55)
Argonantus:
Kdyssi svno jssem etl o njakch vzkumech toho, co ct my, kdy ji por koka. A ssvte div sse, je to sslasst. Kdy organissmuss takto umr, mozek reaguje na pli vyssokou aktivitu nervovch bunk nim lepm a dokonalejm, ne je endorfinem. A ta my ho tedy m v tle hodn? Co ty na to! (a kdy jssi zrann, mu potvrdit z vlasstn zkuenossti, opravdov bolesst sse dosstav teba a druh den!)
Wothan12.3.2003 (14:35)
Napadlo mne....jak by jste popsali njakm hodn primitivnm jazykem za pomoc pmr vzdun vr - torndo?
argonantus12.3.2003 (14:35)
Darkelf:
je to njak mazan chemie, vysloven prodrack.
darkelf12.3.2003 (14:42)
Wothan: Coe? Primitivnm jazykem torndo. Cessta do nebess?
argonantus12.3.2003 (14:43)
Wothan:
pern tk vychytvka. Kdosi kdesi tvrdil, e torndo je v Kosmov kronice - musm se tam podvat, kde to je a jak to vypad...

jinak pokud vm, u sloitch vc se velmi asto pustili autoi do personifikace (viz ty planety, Bh jakoto ddeek a tak...)
darkelf12.3.2003 (14:45)
argonantus: nen to proradn chemie, ta m pipad v celku logick! Pro by mla ssmrt bolet?
argonantus12.3.2003 (14:49)
darkelf:

pozor - pustil ses najednou zase na pole dobroty Bo...! Jak t chvilku nehldm... jak efektn prowothanovsk argument!

Obrtm tvoji otzku - pro by smrt mla bt milosrdn?
Smrt je konec ivota - z hlediska prody nen zejm vbec dn dvod, aby tam njak podobn "anestetick" opaten bylo... pro by mla bt proda milosrdn, kdyby nebyla dna jakmsi duchem... vdomm...?
darkelf12.3.2003 (14:55)
Argonantus: Tyss m nepochopil! J to nemysslm z bo dobroinossti, ale teba ssmrt nen tak patn. Teby process umrn je uloeno v genech (trovhu mimo tvoji mssu) a je vylepena natolik, e je to ten nejsslad orgassmuss na ssvt. Nesslyel jssi o tom, jak sse v anglii dti veli na provaz (a osstan jim hldali ass) a potom kali, e je to lep ne heroin! Ssmrt tedy bude to nejsslad v naem ivot! Possledn dvka endorfinu!
Wothan12.3.2003 (15:20)
Argonaut: ano je, etl jsem to - pochopiteln peklad, protoe neumm latinsky, ale nejsem si bohuel v tuto chvli jist k jakmu roku se to ve...to je dleit pro to jestli to je jet vbec Kosmas nebo u jeho nsledovnci. Mm oboj, jen se mi to bude pomaleji hledat, protoe je pod jet snaz prolistovat to vechno ne se prokousat stohem mch zpisk, vpisk a poznmek akoli jsem si bezpen jist, e tohle jsem si vypsal.
Wothan12.3.2003 (15:23)
Argonaut: nicmn elegantn jste se vyhli, oba, t personifikaci do kter jsem vs tlail...nechtl jsem napsat doslova "personifikujte"...ale dobr, u to sice nen ono, ale tedy personifikujte :-)
darkelf12.3.2003 (15:26)
Wothan: Tak njak chuovka pro tebe. Co je to teplota? Nepotebuje na to bt primitivn, abyss to nedokzal ct!
argonantus12.3.2003 (15:29)
Wothan:
a ako sa to ve k drakom?

Darkelf:
j fakt nevm... tahle zkuenost mi jaksi chyb; smrt plnuji na rok 2066 (respektive poradu s manelkou, co dl); mon e to bude orgasmus... to by nm asi lpe objasnila ta slena, co agitovala nojona Debe (mimochodem, tady by se urit uplatnila, alespo v teoretick rovin...!)

nicmn o jakmsi podobnm efektu jsem skuten slyel jednak v souvislosti s tm obenm, jednak v souvislosti se ralomi toky (a to u jsme tsn vedle drak), jednak v souvislosti s Moodym (a to se zase vzdalujeme...)
adm to do cel ady vc, kter tak njak nedovedu vysvtlit (jako teba, pro se rod na svt zhruba stejn samc, jako samic; pro jsou kytky zelen; pro je v noci tma; a konen, ak to bylo s tm svatm Jim...)
argonantus12.3.2003 (15:39)
Wothan:
Ji, to je zas bordel; jet,e tu del dobu nebudu, aby se to tu uklidilo a pozapomnalo...

personifikovan torndo?
No, mn nasko upln takov ten bl mank, co je v Might and Magic 7 coby ivel vzduchu... m zaloen ruce, nohy neurit mrakovit (spe ne, ne jo), cel je tak trochu prsvitn, kdy do nj bacm, tak od nj odletuj jaksi kapky (mrky?), a cel je tak njak rotan symerick...
darkelf12.3.2003 (15:43)
Argonantus:
Samci pr za pt milion let vyhynout. Nen co eit, ne!
Ale tahle odpov je kvli tv fasscinaci tm bt ssern!

Tak naho nco o dracch?

Myssl vzdun element? Ne? Nebo jak sse jemnoval a ltal tam po pouti!

(na jak dlouho odchz?)
Wothan12.3.2003 (15:47)
Argonaut: je to had. Zdaleka ne vechny tornda maj podobu irokho pravidelnho vru, mnohem astj je (pokud je to vbec vidt) sp zk pokroucen....letc had.
darkelf12.3.2003 (15:49)
Wothan: Ta teplota?
argonantus12.3.2003 (15:50)

Stle jet dychtiv ekm, kam ns Wothan s tou personifikac zathne...

(v ter si mne zase uije k pln hrze, nebre...)
Wothan12.3.2003 (15:58)
Teplota je fyzikln veliina, stejn jako tlak, vlhkost...co s n? Pokud chce argumentovat tm, e ji nevidm a pesto vm e existuje, doplnil bych e ji ctm na ki (jako zmnu) a d se definovat (i kdy zase jen nepmo).
darkelf12.3.2003 (15:59)
Wothan: Tak to chce vyssvtlit malmu dtti, jo? Je to veliina......
darkelf12.3.2003 (16:00)
Wothan: Torndo a had? Jesst mono, pro by ne!
Wothan12.3.2003 (16:01)
Malmu dtti polom ruku na kamna a pak j strm do lednice :-) Pravdou je, e na to abych to mohl popsat nkomu kdo o tom nic nev (co pedpokld e by byl uzaven v njak steriln bace) a neml osobn zkuenost - v tomhle ppad se zmnou - nepoznal nikdy chlad ani teplo bych to pouze slovy vysvtlit nedokzal.
darkelf12.3.2003 (16:08)
Wothan: originln npad a u nejssi moc daleko. No nic, jen ssem t zkouel. Jinak teplota je smr toku energie. Pak u sse d rukama a nohama vyssvtlit.
argonantus12.3.2003 (16:10)
Svt je pln vc, co existujou v plnu 1, ale pro nae smysly jsou jaksi nedostupn... a tm h popsateln:
ta neutrina; barva, vn a pvab kvark; argon;
unik mi, co z toho plyne a co se tm dokazuje...
Wothan12.3.2003 (16:12)
No pnov, pro dneek mne tilo...pohlavkuju se za tu energii - mohl jsem si to odvodit ze sv vlastn mnemotechnick pomcky...to mm z toho e u jsem tu dneska dvno neml bt, ale sedt v hospod a probrat rozvren plakt k manm - bye.
darkelf12.3.2003 (16:13)
Argonantus: Jen ssem vss chtl potrpit, Filossofov!
Fanda12.3.2003 (16:15)
Tak Argonante, na ty prvn otzky bych ti i dokzal odpovdt, ale s draky to nem nic co spolenho.
Apropo tornda - jsou pocjopiteln i v Evrop, akort povtinou v oblastech neobydlench (Skandinvie) a netrvaj tak dlouho, ale pokud sledujete dn, tak jdou u i k nm, nebo se vrac?
argonantus12.3.2003 (16:22)
Fanda:

to jsi fakt dobrej (zvl᚝, kdy v, jak to bylo se svatm Jim..)

docela by mne zajmala ta asociace i u tebe (pro pehlednost - co si vybav, kdy se ekne drak?)

tornda se nevracej; nikdy odtud neodela... a e by dal teorie vzniku drak? No, j nevm... pece jen to vypad dost jinak... i kdy ty planety...
Wothan13.3.2003 (8:21)
Argonaut: nkdo jste se tu ptal na letcho hada - pro by ml ltat zrovna had a ne slon - torndo by mohlo bt odpovd. Skuten doporuuji se nad tm zamyslet a projt si pr fotek a zbr tornd.
darkelf13.3.2003 (9:16)
Wothan: Sslony jssme eily. Gana je taky z nebess!
darkelf13.3.2003 (9:16)
Vem: Trochu mimo.....jak bysste pojmenovali Great Wyrm.....nejsstar a nejvt sstadium draka....vidl jssem peklad jako Velk erv, ale nen to pli potupn pro draky?
S.U.P.13.3.2003 (9:24)
No velky erv nen moc pkn.

Draci jsou peci takov krlovsk stvoen (zvaty se nedaj ani pojmenovat), jsou peci takov hrd. A myslm si, e k tomu maj dvod. Takov velk a inteligentn stvoen vzbuzuje ctu u p pohledu nebo ne?
Wothan13.3.2003 (10:13)
Vyhodit dovzduchu slona pedstavuje bu opravdu velkou protivhu, nebo spoustu dynamitu...vrh hadem by byl asi jednodu. Gama je samozejm bh a bohov jsou bohov, zvlt stran vlastnost, bez ohledu na tvar. Drak je svbytn mythologick postava, to bych nesrovnval. Ale to torndo by bylo hadem, ervem...je to jeden z mla prodnch kaz kter opticky pipomn ltajcho hada, navc bud respekt, m niivou slu, je dostaten velk...
darkelf13.3.2003 (10:17)
Wohan: On taky velmi dlouh mrak pipomn hada? Ale myssl, e byli v Evrop tak asst tornda?
Wothan13.3.2003 (10:43)
Nevm jak ast jsou v Evrop, vm jen e jsou doloen i u ns. Zajmavj je e jsou doloen s vt nebo men intenzitou skoro po celm svt. Mraky jsou ale bn tvary (i kdy nkter skuten pekvap) - torndo ani tam kde je to ast jev tak pln bn kaz nen, navc mrak nen nebezpen - jist e se jej me bt, ale tornda v sousedstv se prost bt mus. Pokud bych popustil uzdu fantasii - mnohem sp bych vytvoil stralivho, nebezpenho ltajcho hada z tornda ne z njakho mraku. Mty stoj na ve - i kdyby tu prvn vc na kter mtus stoj (stejn jako kesansk legendy) vidl jen jeden lovk, nebo jen pr lid, i kdyby to jen patn intepretoval i popustil uzdu fantasii (to je ta otzka vysvtlen si jevu personifikac...te podotkm ale nemluvm o bozch) me nevdom vytvoit mtus "stralivho ltajcho hada" - i lid kte jej nikdy neuvid v nj budou vit a budou jej popisovat. Pokud v co to dovede, sta ti nkdy i jen nachzet stopy po tomhle ivlu - skuten i doml, pak poslou zase jako dkaz jeho ptomnosti. Myslm e na to aby se z tornda stal mtick had sta pekvapiv mlo i kdy s dnenm zpsobem mylen (to nen jen o informacch, to je o celkovm zpsobu mylen a uvaovn) nm podon pstup me pipadat naivn, nesmysln, mon i hloup.
S.U.P.13.3.2003 (13:50)
A co teprve kdy takov torndo vidte v noc?

Takov kus pkn zivch at v reji tornra me nkomu pipadat jako ohe a pak u je jen kousek k zuivmu draku. Je vcelku jasn e takovho tornda si urit vimne vce lid no u kvli tomu hluku co nadl ...... No a pak nen o svdky nouze.
Fanda13.3.2003 (17:13)
Argonantus: Prvn 2 chtl jsem napsat...

A jinak nutno dt za pravdu Wothanovi a pamatovat na to, e i nai pedci mli njakou fantazii a ekl bych, e i stejn dobrou, jako mme my te. Fantasii, kter doke pirovnat viv proud vzduchu k hadovi - nemyslte si, e tm, e kdy vru v draky budeme vykldat jejich existenc, budeme naim pedkm ubrat schopnost snn a fantazie?
darkelf14.3.2003 (14:01)
Wothan:
Pokud v na ji tak hromadn zalessnn zemi sse vysskytovala tornda, budi! Ale zatm dossud jssem nesslyel o tom, e by sse vytveli tornda na d lessy?! Na vyprahlch poutch a mon nad velkmi lny (pklad torndo od Znojma) jo, ale nad lessy? Mon by musselo bt ohromn horko. Me pedsstavovat ltajcho hada? Ale pro sse nezachovali zmnky o obrovitch ltajchc hadech u nss. Pece jenom tu mme ponkud jetrkovitj draky ne napklad v n (a vsskyt ltajchc had v ssevern Americe.....tam jssi sse assi trefil)! Ale j nemm takov hisstorick znalossti jako ty!

Jinak moje otzka trv: Jak by jsste nazvali jinka ten pern peklad Velk erv pro Great Wyrm?
Wothan14.3.2003 (14:34)
Tak to nevm - ze starch hist. pramen je doloeno pouze jedno torndo a to z Prahy a nemluv se tam pmo o hadu ani jin personofikaci, ale o vtru jako ivlu. J to dohledm, zatm jsem to jet nenael - nebyl as.
Fanda14.3.2003 (14:37)
2 Darkelf: Velk had? ..... nebo velk ala ^__^
darkelf14.3.2003 (15:57)
Fanda: J mysslel nco co se k drakum hod? velk had ani velk ala nevisstihuje vznam Great Wyrm!
Fanda14.3.2003 (23:11)
Tak v tom ppad asi jenom velk drak...
argonantus17.3.2003 (10:29)
Ad torndo:
vidm, e Wothan tuhle vc docela slun rozpumprlkoval... na zatku byl Frelinv dotaz z 26.2., a moje nepesn odpov z 27.2. ("bylo vidti ltati hada.")
Prochzm pokraovn Kosmovo, a zjiuji, e to neekl kanovnk Vyehradsk, nbr mnich Szavsk, a to roku 1142, v jedinm odstavci, popisujcm por v Praze (take ns nechv v ndhern nejistot, zda to souvis s tm porem, nebo je to samostatn udlost.)

Poznmka pro netene Pokraovn (Wothane, omlouvm se) - Kosmas umel asi 1126, a po nm pokraovali nezvisle na sob tihle dva manci (mnich Szavsk a kanovnk Vyehradsk) a do krle Vladislava (1140-72), kde k nim pistoupil jet Vincencius. Co nev tihle ti o tto dob, nevme skoro vbec.

Kanovnk Vyehradsk sice nepe o hadovi, ale je daleko zajmavj v tom, e se pmo specializuje na prapodivn nebesk kazy (dnes bychom je klasifikovali jako UFO). Z jeho doby skoro nemine udlost, aby si nepipravil njakou bizarn prodovdnou vychytvku (biskup mlem zabit v Chuchli kamenem, kter se svalil ze svahu a prorazil dm... nebo tak, Fando a Wothane, poslouchejte - bylo vidti kaz, podobn DRAKOVI...)
Problm s tm torndem bude asi v tom, e to slovo se pochopiteln v tehdej ei nevyskytuje... take lze za torndo prohlsit s uritou mrou nejistoty rzn UFa kanovnka Vyehradskho...

Jinak k etnosti tornd - loni jsem vidl torndo na TV Nova natoen nkde na Olomoucku... take nad lesy asi ne, nicmn dost msta na torndo bylo v echch a na Morav zejm u asi dvno...

J fakt nevm. Teorie draka coby tornda me bt piazena jako jeden ze zdroj mtu, podobn jako ta kostra a elektrick potvora... myslm ale, e mi stle jet nco podstatnho unik. Drak je tak njak jet nco trochu jinho.

Ad Great Wyrm: Co "Velk plaz"? Nebo rovnou Veleplaz?
Jinak tahle "ervovit - hadovit" tradice je mon stejn nepehledn, jako ltajc draci, zvlᚴt, kdy se do toho zamotaj vodn Krakeni.. Glaurung byl ostatn tak tento typ.

Uf.
darkelf17.3.2003 (11:35)
Fanda: Velk drak je great dragon a ten pak rosste a rosste a z nj vyrosste....
darkelf17.3.2003 (11:35)
Argonantus: Veledrak, no j!

Te mal, ale prosst otzka: Byli draci u mtickou posstavou ve sstedovku?

Jinak etl jssem tvoji povdku. Chpu Argonanta (nen ssm on nakonec drakem? mon). Pak tak chpe to, e draci u dvno zjisstili, e lid nepinej i pes vechnu jejich pomoc, prod uitek. A proto je nenvid!
argonantus17.3.2003 (12:11)
darkelf:
mtus ve stedovku - kdybys dval pozor, viml by sis, e o tom Divous napsal do Pevnosti v jistm smyslu lnek (heraldickm), a Wothan skoro o niem jinm na tohle fru nemluv...
jiste ano - a dokonce u ve starovku (minimln v ecku, n a u Kelt). Dokonce v na sti svta u s tm slovem (Dragon, draco, drake a tak njak...)
darkelf17.3.2003 (12:14)
Argonantus: Je toho tolik, jen sse ptm! Je toho na m moc mylenky nessthaj. Ale bral lovk sstedovk draka jako to, co me nkdy potkat v relu (vil v jeho exisstenci)?
argonantus17.3.2003 (12:35)
Darkelf:
Podle mne ho o tom vbec nenapadlo zapochybovat. Pokud budu mt tst, najdu nkde prodovdn popis njakho vdce, dokonce z doby jet renesann, ne-li barokn....
jak km, lidi o dracch nikdy nepochybovali, a do francouzsk revoluce - a hned brzy nato vypukli dinosaui...

Napadlo t nkdy, jak velk procento vc, o kterch "v", jsi nikdy v ivot nevidl, nbr ti o nich jenom ekli?
Cel n "objektivn" svt je jedna velk vratk konstrukce...
darkelf17.3.2003 (12:38)
Argonantus:
Um sse chemii a v ivot jssem vidl pouze jenom jeden atom. Ssvt je pouh konsstrukce, m opt pravdu.
Je tedy Argonantuss drak nebo nen?
argonantus17.3.2003 (12:43)
Darkelf:
Kdo je Argonantus, to mi pila trochu sebstedn otzka... a navc jsem to v dob psan povdky neml a tak pln vyeen (Argonanta jsem odloil, a ted mi piel vhod).
Te se mi to jev nsledovn:
Argonantus je mank, kter se zdruje pobl vchodu do Chrmu. Protoe nahl dovnit, ohromuje ty venku kouzly, kter tam odkoukal; jim to pipad dmysln a on se jev jako velk machr; na druhou stranu ho tak obas (prvem) podezraj, e toho zneuv, vindluje a podvd; konen, on sm dobe v, e ta kouzla nejsou jeho; a e jsou nim proti tomu, co zahldl uvnit...
take daleko spe dra sluebnk, ne drak samotn.
Divous17.3.2003 (12:45)
DARKELF nesthm tuto debatu st celou take mi mon nco uniklo....proto se ptm: To tvoje zdvojen "Ss" v kadm slov se "s" m njak objektivn dvod ? Nebo jen vyjaduje svoj originln osobnost ? J jen e to psob hodn trapn
darkelf17.3.2003 (12:45)
Argonantus: I draci sslou drakm!
darkelf17.3.2003 (12:50)
Divouss: zdvojen ss sse pouvalo jet ped ssto lety. Ale abych uklidnil tvou dui, zdvojen ss je z Drowho jazyka. Jakkkoliv podobnosst (pokud ta trapnosst je mylena na narku (ss...jako nck) mi ti z klidnou du oznmit, e tomu tak nen a ani j ssm (zaloenm antifaissta, jak du a tlem) nemm ss tmhle nic sspolenho. Nenaznauje originln ossobu, naznauje Drow.
Pokud sse ti to zd trapn z jinho dvodu, me dvod hledat ve ssv peedssni cannali annaliss!
Divous17.3.2003 (12:54)
A co je to Drow jazyk ? J jen , e s podobnm stylem psan sebeprezentace jsem se u obas na i-netu setkal, ale nikdy se nejednalo o vyzrle osobnosti....spe o tpajc mladky ;-)
No ale neber to osbn
darkelf17.3.2003 (12:57)
Divous: a v vbec kdo jssou Drow?
Wothan17.3.2003 (13:31)
Darkelf: mn by se to taky etlo lp esky :-)
darkelf17.3.2003 (13:36)
Wothan: Tak ssi zvykej!
Wothan17.3.2003 (13:52)
A nechtl bys pst teba polsky?
darkelf17.3.2003 (14:25)
Wothan: Jesstli sse ti to nelb, sstr ssi ssvoji cenzuru moji ossobnossti za zadkovou vsstelku ssvho brnn, jo!
argonantus17.3.2003 (14:26)
double ss:
Mn tohle vbec nevzruuje; rzn lidi psali v rznch dobch rzn ujetosti (mani psali V msto U, pr proto, e se jim to lp sekalo do utru; kdov, jestli nchtli bt jenom zajmav?)
Divousi, nebu tak akurtn, radi pozri, o to elfisko tlach... teba na B na potku...

Osobn jsem ve Forgotten Realms i v Dragonlance pln mimo, take se rd vzdlm...
darkelf17.3.2003 (14:29)
Argonantus: Dk
Wothan17.3.2003 (14:30)
Argonautus: bt zajmav...to jako e chtli udlat dojem na eky? (ehmm...) nebo na barbary? (ano...takov Ambiorix skuten uznale pokval hlavou kdy zmasakroval Cottovy legie a nael njak ty psan zznamy...hle, tohle V vypad skuten vznosn!) :-))

Darkelf: mn je jedno jak pe, jen to vtin lid ponkud znesnaduje ten (i kdy uznvm e ta poltina by byla asi jet hor)....tedy pokud si to nepe jen z irho plezru nco si jen tak napsat, ale sdluje informaci.
darkelf17.3.2003 (14:33)
Wothan: No nic, ale vyloen jsste m tm nassr.....
Wothan17.3.2003 (14:35)
Darkelf: rdo se stalo, jen aby ti to nezstalo i v bnm psemnm styku...v oficilnch lejstrech se to asi vyjm dost blb ne? :-)
argonantus17.3.2003 (14:49)
Wothan a Darkelf a Divous:

prv v oficilnm psemnm styku bych takovou vc ocenil!!
Nevili byste, jak se lid snadno schovvaj za "sprvn provedenou edn formu", pi em tm pouze zakrvaj asnou vnitn przdnotu.
Wothan17.3.2003 (15:41)
Mj styl psan oficiln korespondence je u natolik vytben, e jsem vyrazil omluvu a 78,-K i z editelstv pot, kdy oulili moj enu na balku...je to zanedbateln stka, ale po argumentaci ednk na pepce si to lovk vezme osobn :-)) Jo kadodenn korespondence s dodavateli a odbrateli je zajmav kola praxe.
darkelf17.3.2003 (16:22)
Tak j zkussm nco najt o dracch abychom posskoily (komu sse to patn t, a nssiln zk on bulvy do tvaru keltsskho ke a sstedem vysstr ssvj noss)
argonantus18.3.2003 (9:00)
Vrame se k drakm.
Take pro labunky historickch UFO tentokrt cel citt - kanovnk Vyehradsk, rok 1130, na konci dlouh politick historie prav:
"tho roku dne 8. jna jednu chvli, toti pi zpadu slunce, bylo vidti jakousi obludu, draku podobnou, jak let pes cel echy i pes mnoho jinch mst. Potom vak mnoz vidli jin znamen, velmi jasn, v jitn hodinu."

K tomu je teba si uvdomit, e uen kanovnk byl jednm z mla lid v nevelk a nepli vznamn zemi, kte dovedli pst; pesto nejasn kaz pirovnv k draku jako k vci znm.
To je zrove odpovd na Darkelfovu otzku, jak se dvali na draky ve stedovku.
darkelf18.3.2003 (12:59)
Co takhle dra kultura a jej pedvn mladm generacm?
argonantus18.3.2003 (13:29)
Darkelf:

To u jsi zase v mm svt, ne v plnu 2. Nicmn si myslm, e pokud by draci byli dlouhovc, mli by zkrtka na vechno stran moc asu... dtstv by nebylo jasn ohranien, ale takov drak by se vlastn uil neustle... stejn jako plazi neustle rostou... v tom ppad by st draka mlo skuten jasn spoleensk vznam...
darkelf18.3.2003 (13:31)
Argonantus: Ale urit pedvn ssv kultury by tu mlo bt! draci nejssou nessmrteln a dtsstv provaj urit!
darkelf18.3.2003 (13:43)
Argonantus: (add beholdei) Tak ssem sse dval na jednu sstrnku, ono doopravdy Oko zla (assi behold) m vce ne bohat mytologick koeny!
argonantus18.3.2003 (13:47)
Urit ano. Jenome kdy to pedvn trv destky, nebo dokonce stovky let... na poku je svt jin, ne na konci... nejsem si prv jist, zda za takovch okolnost m jet pojem "dtstv" njak smysl. To se ostatn dje dnes s celou lidskou civilizac tak - nikoli dlouhovkost lid, ale zrychlenm asu.
darkelf18.3.2003 (13:50)
Argonantus: No ale pokud sse jedn o moudrosst tak sstarobylou, jakou je dra magie, tak..
...dtsstv pod exisstuje, vm v nj, ale civilizace zan pro nj udv nkdy pli mal ass. Ve sstedovku to bylo ale hor, ne!
argonantus18.3.2003 (14:01)
Darkelf:
Tohle zase zajm mne... je to dal uhranut; co si ti lid ve stedovku mysleli doopravdy. Toti ti, co vbec mysleli - velk vtina lid vech vk moc nemysl...
Dve jsem pod vlivem veho monho pedpokldal, e byli v uritm napt a strachu ped nesetnmi hrzami... dnes u si to myslm stle mn. Jejich svt jim zejm nepipadal o nic hrznj, ani mn hrzn, ne n.
Dtstv mli asi jasnji vymezen... tko se mohlo stt, e by syn uml nco lpe, ne otec; to je dnes bn zkuenost...
darkelf18.3.2003 (14:08)
Argonantus:Nevm co ssi lidi myssleli ve sstedovku, ale i j, neznal ssvta kolem m ssem sse hrozn bl (a to teda hodn moc), ale assem sse ve m vybudovala jakssi rezisstence proti tomuhle pocitu, mon to bylo vdnm, mon e ne. M nepipad n ssvt tak hrzn, protoe nepemlm nad jeho dssledky (co je mon chyba).

Dobe, jak sse u draci z poznatk osstatnch drak?
argonantus18.3.2003 (14:13)
Darkelf:
Pern tk otzky. Beru si k ruce Nigreona... ono je toti vbec mloco lidskho zajm. Zejmna skoro nic technickho (a to je 90% lidsk mysli). Pro ns je skoro nepedstaviteln, e bychom se nezajmali o obleen, bydlen, dopravu a jdlo.... kdy krtne tyhle tyi vci, vtina lidskch civilizac se odml...
Zbvaj asi vztahy. Hierarchie. Moc. Prostor. as. Hvzdy. Dobr i zl vci, a zejmna dost neuchopiteln...
darkelf18.3.2003 (14:16)
Argonantus: Kdy odkrkne jdlo (zdroj energie) mysslm, e odkrk nco vc, ne jenom cicilizace.......eby cel vessmr! Ale na co jssi reagoval?!
argonantus18.3.2003 (14:21)
Darkelf:
zkouel jsem i pedstavit, jak se draci u od jinch drak... a o em to vlastn je...
darkelf18.3.2003 (14:26)
Argonantus: sstejn jssme zasse uhnuli. No maj Draci pssmo, nebo nco tomupodobn, aby sse ti mlad mohli uit od jinch v jejich neptomnossti. Nebo tohle obsstarv dra magie?!
argonantus18.3.2003 (14:30)
darkelf:
Dra psmo v mm svt vznik magi... pe se na takov velik kamenn stly; kdy to doke pest, dozv se fakt zajmav vci...
darkelf18.3.2003 (14:32)
Argonantus:
Ano, to jssem chtl vdt, take draci zapissuj ssvoje zkuenossti na co? a pomoc magie! Rd bych nkd narazil na jesskyni takovho draka. Zatm z mch zkuenosst bvaj pouze obloeny kosstmi poetilc.
argonantus18.3.2003 (14:34)
Darkelf:
adresu nejbli jeskyn zn. Mj svt je skuten.

Jinak - co jsi kal tomu kanovnkovi Vyehradskmu? Nemysl, e to trochu otese fandologickou sebejistotou?
darkelf18.3.2003 (14:35)
Argonantus: co je to Fandologie? Nikdy m to nedolo!
argonantus18.3.2003 (14:40)
Fandologie je slovo pro dost bn svtonzor, kter na tomto fru zdatn reprezentuje Fanda. Skvostn ukzka je napklad na konci 28.2. ve 12.12.
darkelf18.3.2003 (14:43)
Tud, to otss jeho vrokem o ve! Te ale nasstv otzka jesstli kanovnkovi Vyehradskmu vit i nevit! A zasse jssem v tom nekonenm kruhu vry, e!
argonantus18.3.2003 (14:48)
Darkelf:
Nevidm sebemen dvod mu nevit... z jeho vyprvn mu neplynul dn prospch; a tak netvrdil, e vidl pmo draka - tvrd jen, e vc lid toho dne vidlo nco, co vypadalo nejsp jako drak...

Wothan: Sleduje ns? D se to prohlsit za torndo? Nebo to odlome jako typick UFO?
darkelf18.3.2003 (14:50)
Argonantus: vrme mu tedy, protoe sse nm to urit lb. Kdyss tu urit byli draci!

(ozvu sse za hoku, mizm)

Lady sse njak odmlela?!
S.U.P.18.3.2003 (15:09)
Nevm kde berete takov informace.....strasne vas obdivuji jak se do rozvykladat o takovem tematu jako jsou draci.....

J si draka pedstavuji njak podobn jak byl vyobrazen v jedne he (no piznavam se e jsem s n strvil hoooooooooooooooodn asu) a to v HoMaM II-IV. Vtinou jako ern stvoen chrlic smrtonosn ohe. No a pak jsem si jednou koupil pevnost zaalo to asi 4. slem. U ale nevm ve kterm jsem etl njakou povdku o dracch.... a tam jsem pochopil , e drak nemus bt jen zl, ale zale i na tom jak se s nm jedn.

Ty bytosti co se bli drak je povaovali za nebezpen a zl, ale nali se i tac co si s nmi dovedli vymnit i pr slov a dokonce se dokzali s nimi ptelit. No to jsem mon njak zmotal ale nemu zato.... dnes jsem toho ml u dost. A to nepiju..... Sta jen hodn dlouho civt na tu bednu co te civis ty a pak je to vechno takov njak pomotan....:o)

Nevm jak na vs ale na m psob slovo Drak vclku hezky. Zato Great Wyrm se mi moc nezamlouv pipad mi njak tak tvrd oznaen neho jako je drak. Take mam zato e Great Wyrm nem s draky moc spolenho. Snad jen to e um ltat a chrlit ohe asi taky neum. Nco mi k e by mohl produkovat sp njakou formu kyseliny.

Take Great Wyrm by mohlo bt nco jako Velk ltajc erv nebo nco podobnho velkm ltajcm dinosaurm. Rozhodn nem stejnou charakteristickou ki jako draci. Draci maj peci upiny ale n jako ryby ty je nemaj tak pancovan.

No to jsem toho napsal.

Jo, kde se d sehnat nco o tch Drow. Dk darkelfe.....

Dk za odpov S.U.P.
S.U.P.18.3.2003 (15:26)
Nevm jak vy ale ja neslyel nikd o vce dracch na jednom mst... Take jak se mohli jeden od druheho uit ?

Nedokau si pedstavit jak by chodili teba do njak jeskyn kde by se dokzali nauit nco smi jen tak civnm na ze s npisy nebo jen s kresbami.....

Nevm a le pipada mi to asi tak e u museli aspon nco znt tj. norodit se u s tm e umli mluvit..... umli vbec mluvit a jakou e tedy mluvili?

Zase m napad spoustu otzek jak co a pro.... ne ale dotu to frum tak u zase nevm co jsem chtl....

Ach jo..asi si to budu pst...nkam bokem..
argonantus18.3.2003 (15:50)
S.U.P.:
Vtm dalho drakologa. Uznvm, e nae frum je u hrozn nacpan; j to technicky em tak, e si pspvek, kter mne zaujme, cel "nasaju" do clipboardu, vypustm ho do svho novho, pak na nj odpovdm a to pvodn mau. To pesn provedu s tebou. Take:

- informace bereme rzn; nen obr se omezit jen na fantasy a hry. Pokud to projde opravdu dkladn, najde tu velkolep odkazy na ryze dra strnky.

- HoMaM samozejm znm, draci ern jsou tam prakticky nejlep potvory vbec (snad s titny a archandly). Pro ern draky mm obzvltn slabost.

- jak u se eklo, drak m pern starou tradici i jako slovo; vlastn nen u ns na Zpad kloudn civilizace, kter by draky neznala. Kdy a jak vznikl Great Wyrm, to se zeptej Darkelfa.

- chrlen ohn, kyseliny, jedu a veho monho - zaali jsme s tm nkdy 3.3., a najde tam vci, nad ktemiti bude pechzet zrak (mn teda pechzel)
Fanda18.3.2003 (15:56)
Nejprve zaneme tm psmem - otzkou je, zda-li by tak dlouhovk nrody s tak dobrou pamt, jako jsou draci, nebo i elfov, potebovaly psmo na zznam toho, co se stalo nebo udlalo - nemluvm te o pedstavch kohokoli - berte to jen jako otzku hozenou v pln.

Mno a jakoto zakladatel Fandologie ^__^, bych se ml vyjdit ke kanovnku Vyehradskmu - moj prababiku pr topil vodnk - ona ho vidla a jeliko se vodnk vyskytuje v lidov slovesnosti od dvnch dob, dalo by se pedpokldat, e vodnci jsou, nebo alespo byli. Otzka je, zda-li vyprvn m prababiky o tom, e vidla vodnka (zaloen na jej ve v jeho existenci), dokazuje existenci vodnka.
Obvm se, e ani kanovnk Vyehradsk s Fandologi pli nezacloum, protoe, jak vm potvrd kad etnograf, lidi zkrtka kecaj a ned se jim vit - co my vme, teba chtl bt zajmav, nebo mu to povdl nkdo, kdo to slyel od nkoho jinho. Ostatn tum, e jin kronik - Dalimil, kecal, a se mu od pera prilo. No a kam vlastn to stvoen letlo? Je zznam jet v njak jin kronice z Polska, nebo Nmec? Teba to nakonec byla Enterprise zen Kirkem ^__^
J si toti myslm, e stejn jako je zavdjc pedstava Boha (nebo jak si to nazveme) jako staeka na oblku, je stejn zavdjc i pedstava draka jako okdlen jetrky, co plive ohe, nebo vodnka, jako zelenho muka na vrb.

A doufm, e si i dky mm narkm lpe promyslte existenci drak a vemon dkazy o n - a najdete nco neprstelnho, pak mi nezbyde ne existenci drak jakoto tch jetrek uznat.
argonantus18.3.2003 (16:05)
Fanda nesnesiteln:
dk za nemilosrdn materialistick pstup. Docela to oivuje frum.

kanovnk Vyehradsk: netvrdm samozejm, a netvrdil to ani on (vimni si pozorn), e vidl draka, nebo:
1) vidli to "jin" lid, a asi na rznch mstech
2) nebyl to drak, nbr "nco jako drak", a krom toho, hned vzpt, "jet nco jinho"

nevyvozoval jsem z toho existenci drak, ale spe pozouhodn stav ideje draka v t dob - neznm jev je popisovn odkazem na draka jako na vc zejm zcela jasnou a znmou (opakuji, mluvm o prakticky negramotnm roce 1130 v echch, kter sestvaj pevn z pustho lesa).

Za velmi n욝astn ovem povauji nakldn se zprvou tm zpsobem, e pokud se mi nco nehod do krmu, odplkuji to mezi vmysly, sny a podobn. Tem mi to pipomn barona Cuviera a jeho boj proti lovku neandrtlskmu.
Wothan18.3.2003 (16:49)
Argonaut:
Jako esk romnsk patriot bych si dovolil s tou pustinou trochu zapolemizovat...no sp z hecu, jinak plon vzato to tak tady potkem 12.st. asi vypadalo.

Fanda:
Kanovnk Vyehradsk toho natst napsal vc a mme tak alespo pedstavu jakm stylem psal a co popisoval. Jeho styl psan je od Dalimilovy obraznosti pece jen odlin - a pokud bys chtl skutenho vyprave doporuuji Hjka a jeho kroniku :-) Soudm e je to podobn jako Kosmas dvryhodn pramen. Ale jak psal Argonaut - celkem nezaujat zapsal to co se mezi lidmi vyprvlo, prost pro to e mu to pro dan rok pilo zajmav (s ohledem na vhu pikldanou tehdy vemonm a zvlt pak nebeskm znamenm to nen nic zvltnho). Kdokoli by psal pro to aby byl zajmavm, napsal by to urit jinak - mohl se prohlsit za svdka toho jevu, mohl jej podat podstatn barvitji...on ale msto toho velmi strun reprodukoval to co se mezi lidmi ilo. Nenachzm tu nic co bych mu vytkl. Jinak tohle nen dkaz existence draka - chpal jsem to jako argument pro to e tu ji tehdy byla mezi lidmi njak pedstava o tom jak by asi ml takov drak vypadat, kdy tomu jevu pisoudili tuhle podstatu. Aby tvoje babika mohla tvrdit e ji sthl vodnk musela mt njakou pedstavu jak takov vodnk asi vypad a pro to dl ne? A je v tuhle chvli celkem jedno e tam dn vodnk nebyl. beru ten argument jako odkaz k existenci vitho archetypu, nic vc.
Wothan18.3.2003 (16:50)
Tedy Kanovnk je podobn jako Kosmas i Mnich Szavsk v mezch monost dvryhodn pramen...ne ten Hjek :-))
Argonantus18.3.2003 (17:14)
Wothan:
jo, tak pesn to vidm. Podotkm jen, e kanovnk Vyehradsk se rd a mnohem astji dval ma nebe, ne vtina jeho koleg (mnich Szavsk, Kosmas atd.)
Jinak - co by ekl Fanda zcela materialistickmu vysvtlen; teba takov meteor? Let, chrl ohniv efekty, mohou ho zahldnout z vc zem...

Jinak jsem zatm pes sebepelivj hledn v Kosmovi i v Pokraovn nenael lep torndo, ne toho mnicha Szavskho - "bylo vidti ltati hada", k r. 1142...
Wothan19.3.2003 (9:00)
Argonaut: hledm taky, ale zatm marn - co si ale pamatuji tak tam nen zmnka o dracch ale o vtrnm vru kter tum e smetl z mostu jezdce...(pokud si to nepletu s jinou udlost)...hledm dl.
argonantus19.3.2003 (9:57)
Wothan (a vichni piznivci a odprci stedovku):

Tak, ptel, jdu do toho. Donutili jste mne projt celho Kosmu i Pokraovn, abych shledal nsledujc:

1) Kosmas byl paprov intelektul, kter se na nebe a produ dval minimln; spoustu historek konstruoval ist literrn; nicmn byl ve skutenosti milovnk pbh, a to i pkn epickch a hrdinskch. Pro nae ely je dost nanic.

2) Mnich Szavsk je odpovdn za vtinu povtrnostnch vsuvek v Kosmovi. Krom toho hada 1142 jich m jet nkolik; zvl᚝ mne zaujalo, e v kritickm roce 1130 prav, e
"dne 25. dubna zjevilo se obrovsk znamen a bylo slyet hrozn hmn." Pravda, o pl roku jin datum, ne kolega z Vyehradu - ale protoe to oba psali zejm ex post, po mnoha letech, nen nhodou mon, e mluv oba v roce 1130 o te udlosti?

3) Kanovnk Vyehradsk - to ovem skuten perla. Za pouhch 16 let jeho kroniky m njak zajmav UFO skoro kad rok, a jeho pozorovn jsou okouzlujc svoj vcnou pesnost.
Najdeme tu boue, sesuv pdy, nkolik novch hvzd (? komety i novy - ted nevm), nkolik netypickch zatmn msce, meteor, slunen skvrny a tak pr nejasnch UFO, jako ten drak roku 1130.
Zjmu o nebe v tto kronice si vimlo u i pr profk, take nkde existuje pojednn "Astronomick zprvy v kronice vyehradskho kanovnka", Link, 1961; a tak "O astronomii a kronice a jak to spolu souvis" od Linka a Ivanova.

4) krom roku 1130 - kter pro pehlednost cituji znova:
"tho roku dne 8. jna jednu chvli, toti pi zpadu slunce, bylo vidti jakousi obludu, draku podobnou, jak let pes cel echy i pes mnoho jinch mst. Potom vak mnoz vidli jin znamen, velmi jasn, v jitn hodinu."

je zajmav tak rok 1135 s tm meteorem:
" V Durynsku spadl z oblak na jednu rovinu kmenm divn velikosti, jako velik dm, zvuk od nho slyeli v okol bydlc lid u po ti dny naped; kdy dopadl, polovice se ho zaryla do zem a ti dny leel hork, jako ocel z ohn vytaen."
To jen na vyvrcen mho vlastnho npadu vysvtlen r. 1130, a tak na ukzku t pesnosti a seriznosti (jsem si jist, e njak Fandolog okolo r. 1800 by to jist tak prohlsil za vplod chor mysli...)

a konen - OBZVLT zajmav je rok 1138:
"Dne 26. nora po zpadu slunce bylo spateno po celch echch jaksi znamen v podob draka, jak let na zpad, a nhle zmizevi, zanechalo za sebou naervenal znamen.
Ped letnicemi, dne 11. kvtna, se zjevila na severn stran na nebi erven znamen ve tvaru sloup, na dv sti rozdlen, a zdlo se, jako by se v boji utkvala, brzy zase vzdalovala."

take - mme tu u druh drakoidn UFO (a tentokrt se jedn zjevn o cosi meteorologickho i astronomickho, vzhledem k tm ervenm znamenm), a vzpt to slben torndo jako lusk.
Nenapad mne lep dkaz, e torndo nebvalo zamovno s drakem; alespo u zkuenho machra, jm je nepochybn n vten kanovnk.


5) P.S. S tm Dalimilem jste mne fakt nasrali... neexistuje prkazn msto, kde by si Dalimil nco vymyslel; pouze pletl doby a zskan prameny - ale to je tm na samostatn dlouhatnsk frum, ve kterm bych byl asi brzy sm.
argonantus19.3.2003 (10:17)
a na leh notu - bhem na debaty se objevily na hlavn strnce dva lnky od "darth bane" Vejnara, oba o dracch... ten pedtm, od nkoho jinho, se mi lbil vc...
Wothan19.3.2003 (10:36)
Argonaut: no - zkus srovnat Kosmu s Dalimilem. To e si plete data je jedna vc, ale j jsme psal e Dalimil oplval pedevm mnohem vt obraznost ne jeho pedchdci, ne e byl pmo fabultor (co bych teba u Hjka s klidnm svdomm ekl). Zajmav je to pedevm tam kde nepopisuj skuten hist. udlosti ale mty (Vyprvn starc) - srovnej teba Dv vlku Kosmovu s Dalimilovou? Dalimil bezpochyby neml vc podklad a pramen ne Kosma, bezpochyby Kosmovu kroniku znal, ale jeho pohled na stejnou povst je nepomrn barvitj a venkoncem vyznv i pln jinak. Tolik co vm o tzv. Dalimilovi.
argonantus19.3.2003 (10:40)
Wothan:
Dalimil - dejme tomu, takhle bych to bral. Ale jak km - to je na jin frum; nezasviujme si draky.
Sp mne zajm, co k mmu vlovu z Pokraovatel?
darkelf19.3.2003 (13:26)
S.U.P. :

Draci ( v tom m pravdu jssou v podsstat ssamott), ssnad dky jejich neutralit, ssnad je to o tom poznat co nejvce novch vc (kad v, e kdy je ssm, m na ssvt ponkud jin pohled, ne kdy je ve dvou). A protojssem (ssnad i z nouze) nadhodil otzku o dra kultue, pssmu nebo nco jinho.

No dra pssmo vytissknut do sskal pomoci magie nen tak zasse hrozn. Pokud vezmeme draka jako nco, co dla dozorce nad vyuitm prody, mohli by drac sst z pouhch nessrovnalosst kamennho povrchu. Podle mg vm, e pokud chce sspojit ssvoji myssl ss elementrn pln zem (a vyut jejich moci, znmou jako zemn maggi) potebuje ovldat jejich jazyk. To by znamenalo, e draci zapissuj ssvoje ivotn zkuenossti dky magii, prod nejbli.

Draci v HOMAM bvaj assto ssmrtonossnou zbran, a pokud jssi vidl draky azurov, tak mon i vce ne ssmrtonossnou..

Draci nejssou v podsstat naklonni zlu, jenom dlaj to, co ct, e je ssprvn, a kdy tomu pite jejich neobvyklou moudrost, d sse ct, e chyby dlaj hodn mlo (nebo jednoou za ivot)

Great wyrm: je oznaen v bestich ADnD: je to forma draka, kter m vce ne sstrn moc let (z hlavy ti to nepovm). J vm, e oznaovat draky podle toho jak jssou ssta, je hloup, ale kdy to vidm v esskch pekladech jako Velk erv?!

O Drow ssem ti nco mlo posslal na email, pokud sse nebude zlobit!
darkelf19.3.2003 (13:49)
Fanda: Elfov maj ssv pssmo, ale dleit vci (jako to kdyssi dlali druidov) se pro mon zneuit pedv sslovy!
darkelf19.3.2003 (13:56)
Argonatus:
V lidssk hisstorii sse hrabat nebudu (ssnad je to mm pohrdnm, ssnad tm, e bych nic na to neekl)
Je logick, e sse ti lnek nelbil, zessmuje toti draky, ale m, Dow, naopak zaujal a doela jssem sse u nj pobavil!
argonantus19.3.2003 (14:14)
Darkelf:
ne snad pmo nelbil... to by bylo zbyten krut... jenom mi piel pli po povrchu vci klouzajc... mm rd vci zneklidujc, co pronikaj pod ki...

Nemohu po kadm chtt, aby mne ohromil Wothanovskm pvalem asn pesnch fakt... ale njak mi unikl autorv POSTOj k drakm, co u jsem vysvtloval na Bohu... nevad mi posmn postoj (draci to klidn vydr), sp mi vad przdnota
darkelf19.3.2003 (14:16)
Argonantus: ber to jako fejeton k nai disskuzi!
Fanda19.3.2003 (14:19)
No, co j se na sebe jet nedozvm ^__^

Argonantus+Wothan: J nekm, e si toho "draka" kanovnk Vyehradsk vymyslel a tou phodou s moj prababikou jsem chtl poukzat prv na to, e ze znalosti, jak by takov drak ml vypadat, me dojt k pojmenovn njakho jevu jako draka, co jste vy dva ostatn dostaten vyjdili ne. A hlavn jsem chtl oponovat a fantickmu Darkelfovu pijmn veho, kde se njak drak vyskytuje. A piznejme si jeden smutn fakt, e le, a chtn, nebo nechtn, je stle a vdy jednou z monost a tak njak je dobr s n potat - ovem ne fanaticky vyznvat - pak je to tak na nic. Spe jsem chtl poukzat na to, e podobn zmnky je dobr podn zanalyzovat, ne se zanou vynet horenat verdikty nad existenc drak.

Darkelf: A kde si sebral, e elfov psmo mli - ano, Elfov v Tolkienovi psali, psali i elfov v Sapkowskm, jene jsme tu zase na tom samm co s tmi draky a ekn me si, e jet he, protoe pedstava elfa se rozila snad a dky Tolkienovi - pokud tedy bys pod tmto vlivem neoznail slovansk vly mahem za elfy. Pro m, za m, v si v existenci elf a drak, kdy to z tebe bude dlat dnho lovka, ale nevnucuj svou vru ostatnm za pravdu.
argonantus19.3.2003 (14:20)
darkelf:
beru.

Wothan: Co ty na zhroucen teorie tornda? (dnes rno)

Fanda: tebe se radi neptm - vlastn nevidm dvod, pro by se tvj nzor ml vlivem dalch podobnch zprv jakkoli vyvjet

S.U.P. - azurov draci mi u moc k srdci nepirosli... eho je moc, toho je pli...
darkelf19.3.2003 (14:26)
Fanda:
Dk, e sse o m boj (doku jet ale t i v thle rovin)
A elfov, to je tvj nzor, ale nkdy v ivot pozn, e vechni bjn tvorov maj uritou pedlohu v lidech a jejich chovn, take kolem ssebe najde mnoho elf a mnoho jinch sstvoen......jinak jssme na fantassy sserveru, pro bych nemohl rozvjet nessmyssln teorie o tch, co jssou m dui nejbli:)
darkelf19.3.2003 (14:27)
Argonantus: Azurov draky jssem nadhodil j!
Wothan19.3.2003 (14:36)
Argonaut: njak jsem nepostehl e by se teorie tornda njak hroutila. Mla by?
argonantus19.3.2003 (14:43)
Fanda lehce z mry vyveden: (bezva, je to osobn!)

Nesprvn interpretace faktu jet zdaleka nen le. Realita m mnohem jemnj odstny.

Jinak pipomnm, e v thle debat neustle peskakuji z rznch realit; zprva kanovnka Vyehradskho je pece jen nco dost jinho, ne moje - ist z mho svta a mnou vytvoen - informace o dram psmu, tvoenm magi; moc pevn si za tm nestojm
(geniln citt jednoho mho znmho: "Zde stojm, ale mohu i jinak!")

Nepjemn i pobuujc nen mono ztotonit s "horenatm" - ten, kdo k pobuujc vci, bv naopak daleko astji ledov klidn (viz Divous a double ss, i kdy jsou mon i jin verze vkladu)

Elfy odkazuji k jinmu fru - jinak v zsad souhlasm, e nelze bezdue tolkienizovat

A to hlavn - vra v Drow nebo v draky - i naopak nevra - nein lovka dobrm, i patnm (viz shodlouh debata o Dobru na Bohu)
argonantus19.3.2003 (14:44)
Wothan:
obvm se, e je pinejmenm ohroena - dnes, v 9.57 jsem ve svm shodlouhm vlovu objevil to torndo.
Wothan19.3.2003 (14:48)
Bu jsem slep nebo jsi to torndo nenael. Byla to naprosto zeteln zmnka o vzdunm vru. V t zmnce nen ani pirovnn ani jin personifikace tohoto zjevn prodnho jevu. Kdy jsem o tom mluvil tak jen jako o dkazu existence tohoto jevu i v echch ranho stedovku - jist se tu nco podobnho mohlo objevit i dve.
argonantus19.3.2003 (14:54)
Wothan:

s nehynouc lskou k tob lapm do clipboardu a kopruji:
rok 1138:
"Dne 26. nora po zpadu slunce bylo spateno po celch echch jaksi znamen v podob draka, jak let na zpad, a nhle zmizevi, zanechalo za sebou naervenal znamen.

Ped letnicemi, dne 11. kvtna, se zjevila na severn stran na nebi erven znamen ve tvaru sloup, na dv sti rozdlen, a zdlo se, jako by se v boji utkvala, brzy zase vzdalovala."

Dv zprvy, bezprostedn za sebou, tent rok, ale jin datum. ta druh je podle mne torndo jako vrata (erven znamen ve tvaru sloup).

A k tomu mj rann koment:
Nenapad mne lep dkaz, e torndo nebvalo zamovno s drakem; alespo u zkuenho machra, jm je nepochybn n vten kanovnk.
darkelf19.3.2003 (14:57)
Ale drak je sstar ne Kanovnk, to ssnad myssle othan, n?!
darkelf19.3.2003 (15:01)
....myslel Wothan...
argonantus19.3.2003 (15:06)
Darkelf:
te jsem zbloudil ve vech realitch...
idea draka je zaruen mnohem star; o to se asi nikdo nepeme (jak jinak by se mohli dostat draci na Keltsk mince?)

Pokud jde o draka, kterho vidl kanovnk, pak jsou jejich st rzn odpovdi:

1) v Plnu 1 lo o UFO, a tud byl star kanovnk (neb drak zanikl)
2) V Plnu 3 - m realit - to byl mon Nigreon, a pak byl nepohybn star, ne kanovnk
3) nebo to byl jin drak v Plnu 2, neprokzan a nevyvrcen, a o jeho st nemm dnch zprv.
4) A to jet vynechvm, e kanovnk vidl draky dva.

Je to jet srozumiteln?
darkelf19.3.2003 (15:08)
Argonantus: ale to nevyvrac, e kdyssi dvno nkdo mohl povaovat torndo za draka. Ale je jisst, e tahle pedsstava jako draka sse nedoila sstedovku!
argonantus19.3.2003 (15:12)
darkelf:

Jiste m pravdu. Dkaz to nen. J tak povauji kanovnka za nadprmrn schopnho pozorovatele (ve srovnn s konkurenc) - je docela mon, e mnich szavsk si tornda a draky pletl... co jinak m znamenat to pratn "bylo vidti ltati hada?"
darkelf19.3.2003 (15:15)
Take torndo m vce sspojitosst ss ltajcm hadem, ne ss drakem
S.U.P.19.3.2003 (15:17)
Ti Azurov draci byli ti co mli njakou tu magii v inventai je to tak?
darkelf19.3.2003 (15:18)
S.U.P: Ne to byli pohdkov draci. Azurov byli ti mod a velmi ssiln, co zpssobovali sstrach!
S.U.P.19.3.2003 (16:58)
No ja jsem si to pozdjc taky uvdomil ale pozd byls rychleji u netu.... darkelfe :-)
Wothan19.3.2003 (17:01)
Argonaut: no nevm - ty sloupy bych za torndo asi nevydval, to prost nen ta zprva o kter jsem mluvil j. To nijak nepodporuje mou tezi - vimni si e te se sp v zjmu objektivity poprm :-) Ale co jsem tvrdil j nen to e torndo bylo v dob Kanovnka Vyehradskho (nebo Kosmy, Mnicha szavskho a ert v koho jet v dob historick) bn povaovno za ltajcho hada. Ber to tak e abys z tornda udlal mtick zve musela by spolenost bt na mnohem ni, primitivnjm stupni vvoje. Kdy zafabuluji - kdysi v dvnovku (be jak miliji tuhle terminologii) lid mnohem jednoduho raen personifikovali vzdun vr a dali mu tvar. Na tuhle kostru v prbhu vk navsila lidsk fantasie tvar a vznikl mtus - ltajcho hada, draka...to ale neznamen e se tto personifikace mus apriori uvat navky. V dob Kanovnkov u mon nevidli v torndu draka ani ltajcho hada...zato ten archetyp u tu byl "odjaktiva" (u zase...) zaset, proto vdli kam maj v ppad pirovnn shnou "podobn draku..." apod. Jasno?
Fanda19.3.2003 (19:27)
J si kal, e jsem si kapnek nabhnul.. -_-""" *ervenm se*
A pokud to Darkelfe bere takhle, tak nezbv ne souhlasit.
S Argonantem souhlasm a v podstat jsem to i psal.
Jinak m t, e i jin tady spekuluj o vrohodnsti jednotlivxh dkaz ^_^

No a kdy u je to ten fantasy server, co takovhle pedstava o dracch:
Jsou 2 typ - draci Zem a draci Nebes. Draci Zem jsou jsou ochrnci planety a s nevol sleduj, jak ji lid ni. Draci Nebes jsou naproti tomu ochrnci lid, neb si uvdomuj, co vechno krsnho lidsk kultura uinila a zrove oni jsou strci 7mi peet, jejich znien me vst ke zkze lidskho rodu. Drak je 7 z kadho rodu a je to jaksi prapvodn sla, kter ale sdl v tlech uritch lid a propjuje jim nadpirozenou moc.
Tolik prvn st poudaky.
argonantus20.3.2003 (9:04)
Fanda:
Poudej dl, babi. Mon to bude zajmav; bude mon sm pekvapen, co zajmavho haraburd nos v hlav.

Wothan:
No jo. To spolu zase sp souhlasme. Mohu snad jen jemn upesovat - neobvyklost tmatu a nevzdlanost pozorovatele jsou v pm me s mrou personifikace...
zatmco obyejn "chlap" nkde na poli by dvno blbolil o blech, nebo kdovem, n docela prodovdn zbhl kanovnk uv slova, kter podle nj nejlpe sednou, a popisuje pesn, co vid - "dva sloupy, kter jakoby zpas." Kdybych nesml ut slova torndo" nebo "vtrn smr" (protoe o fyzikln podstat jevu nevm na dlku vbec nic), mon, e bych nic lepho nevymyslel...

mimochodem - pekvapilo by t hodn, kdyby ten kanovnk opravdu vidl nad Vyehradem draka? Mj svt by se nijak nezhroutil.... a mimochodem, odboka - prv tak vznikaj zrodky umleckch npad. Chce se to jen do t situace dokonale vt (a to jako milovnk stedovku jist dl asto). Kanovnk sed nkde u kapitulnho domu venku, popj njak staroitn chlast )j vm, e by neml, ale urit to dlal), krsn den, nad Vltavou lt ptactvo nebesk, dole zdlky je slyet nejasn kecn hdajcch se deva z Podskal, a najednou - drak...
kanovnk nen pekvapen; sleduje to se zjmem vdce...ale ns napade - odkud a kam ten drak let, co m v myslu, co z toho veho vzejde...
darkelf20.3.2003 (9:39)
K drakm: Taky povauji sst drak jako ochrnce a sstrce prody, ale jak jssi doel k tm ochraovatelm lid. Pro by je chrnili?
Wothan20.3.2003 (11:14)
Argonaut: pro by nemohl pt? Nejsp by pil vno, ale i medovinu...crkev v echch 12.st. je otzka sama pro sebe a k njakmu idelu m velmi daleko. To e by byl dobr kronik zpit namol (co netvrdm) by byl jen zanedbateln proheek vedle bn praxe na kterou tu narazil chudci legti Guido nebo i Petr z Capuy :-)) Nepochybn zn personln zemtesen, kter tu oba dva v rmci crkve provedli pot co se vzpamatovali z prvnho oku...kupkladu vyehradsk kapituly byl enat, ale navc laik a pro zmnu dkan te kapitoly kter sice nebyl laik ale ml pro zmnu ti manelky...dkan a kanovnk Olomouck kapituly dostali padka pro nemravnost apod. Taky nechyblo moc a Petra ubili rozzuen kn za to e si dovolil dat po nich pi svcen slib celibtu.......j od dob kdy tu prvn misioni zhnusen prohlsili e tu buj kult nevzanho sexu a medoviny se toho ani v tto osvcen dob mnoho nezmnilo :-))
Wothan20.3.2003 (11:16)
Probot vyehradsk kapituly ...vypadl mi z textu. Omlouvm se tohle nen od racch a je to off topic, to je jen tak na okraj jako pspvek k boen mt a zakoennch pedstav i idel :-))
argonantus20.3.2003 (11:40)
Wothan:
ne, j s tm opt naprosto souhlasm; a jako tvora bezbonho mi lajdck pstup naich pedk ve 12. stolet (o kterm se dajn vyprvly anekoty v dalek Francii - pr tehdy esk knz= n dnen policajt) imponuje a napluje zlomyslnm endorfinem, naopak takov tpci, jako Bernard z Clairvaux, Jindich Zdk, nebo i mj dvn esk jmenovec, mi li vdycky na nervy... ale to je sp k tmatu Bh.

Chtl jsem jenom v t sv umleck ilustraci poznamenat, e kanovnk vyehrads
se mi skrz ty dky jev bt jako prv typick esk pohod, co msto modlen rence radi pozoruje draky a jin vstednosti...
S.U.P.20.3.2003 (12:44)
kdyby existovalo frum kde by se dalo jen tak sedt a pozorovat draky.

No jo to by nebylo vbec patn.

Tak m napadlo mohl by upr njak vyst drakovi krev?

Podle m maji draci velmi dobe pancovan tlo :-)

To by mu muse lvlzt njak do nitra ale...vezmuli na vdom e by ho to mohlo pkn poplit... dal otzka jak vznik vlastn ohe v drakov tle?
Wothan20.3.2003 (12:45)
Argonaut: vid? bez konflikt nen dn plodn diskuse....e bychom se vrtili k drakm, sexu a medovin? :-)
argonantus20.3.2003 (12:56)
Wothan:
no, mohl bych dle rozvjet tma konfliktnm zpsobem; napklad, e drak nad Vyehradem byl ve skutenosti pokmon charmander, prv vvojov stdium (to kouk, co se lovk taky nkdy mus uit...!)- ale je mi to samotnmu proti mysli.

Ale je jet tisc vc, co chci o dracch vdt; nkter jsem u nahodil, ale nikdo se mi na n neozval; ale v nkterch vcech projevuji dsivou trplivost (napklad - Merkurius, sv. Ji, Darkelfem slben mrazc dech...) Kdysi jsem chtl napsat o dracch knihu; pak jsem si ekl, kdo to asi tak bude st; nae to nkdo vydal (Montse Saint a Ciruelo - Draci, moc hezk kniha) - nicmn nakonec nelituji, protoe jen na tomhle fru jsem se dozvdl spoustu novch vc...

S.U.P. - to t k tomu pivedla Lady Candar jinde? No, asi by mla uprka problm to vechno vypt... ale tm jsi mi pipomnl asnou mylenku nemrtvch drak. Myslel jsem, e je to mj vlastn npad (pouil jsem to v jednom RPG s velkm spchem, kdy padoui oivili mrtvolu dve zabitho draka), nicmn pak jsem to nael u toho Ciruela, kde je kostliv drak dokonce krsn vymalovn... a jet potom jsem je nael na HoMaM, kde je to normln vc. Take zase nejsem pvodn. Nicmn, zajmalo by mne, jestli jsi na tenhle len npad narazil v "dvnovku", Wothane
argonantus20.3.2003 (12:58)
S.U.P. -
promi - ten ohe - i tohle nai drakovdci na tomhle fru asn eili, je to nkde v polovin. M-li jen obyejn pipojen via Telecom, doporuuji cel tohle monstrum nast, odpojit se, uloit a prostudovat.
S.U.P.20.3.2003 (13:02)
Tak ten ohe jsem pehld ups..


Jinak m by se takov kostn drak mohl ivit.... jak by to travil....viz HoMaM to je nco jak funguje kostlivec me vbec nco takoveho realn existovat?
Wothan20.3.2003 (13:03)
Argonaut: kostn drak? Mm kostn heben, dlo, jehlu...ale draka jet ne. Ale vn - nco takovho by skoro automaticky odkazovalo k foslim i kdy pohybujc se foslie jinak ne pi sesuvu svahu nalezit nebo zemtesen v muzeu asi bn neuvid. A k dram revenantm - nikdy jsem nic takovho v mythologii neslyel. Ono vbec spousta zhvilost vznik z per a mozk autor a hr her a to jsou vci kter mne mj a neoslovuj. Spousta potvor a bastard vm tu vznik jen z technick poteby skloubit njak vlastnosti a el zjevn svt prostedky...ale jak km, pokud vane vtr odtud (stejn jako ti pokmoni) tak tomu j vbec nehovm a nerozumm.
S.U.P.20.3.2003 (13:04)
pipojen pevn nemocnin linka...
argonantus20.3.2003 (13:10)
Wothan:
jist - je to jen fantastick maximalizace (jako ten teoretick radioaktivn drak, kterho zavrhl i velmi tolerantn Darkelf).
Moje pvodn podezen bylo, e prv tak njak vznikl dvno i mtus chrlen ohn - m by byl drak jet asnj, ne nejvt zbran hromadnho nien t doby... na zpsob eckho ohn, e? Apropos, existuje njak ohnstrjn drak oped vynlezem eckho ohn...? Nikdy jsem si tuhle otzku nepoloil...

nicmn - jako umlec nesouhlasm. Nemrtv maj svoji nepochybnou magickou slu a tradici. Nemm dn dvod v n vit reln (narozdl od drak), ale mylenka je to vpodstat velkolep, protoe msi zneklidujc... je tu tak takov jist mra pravdpodobnosti... setkal ses nkdy s opravdovou mrtvolou?

Nemrtv drak pochopiteln nej. Je nemrtv; spojuje poezii nemrtvho i draka; je pern ciz.
argonantus20.3.2003 (13:44)
Jet, ne se pro dneek odmlm, dluno poznamenat, e jme provihli mal jubileum - tst pspvek (a tm doasn druh msto za elfy - le nezoufejte, TrPaci - ve se me zmnit).
Tuil jsme, e Draci jsou siln tma - ale vsledek mne samotnho pekvapuje. Dkuji vem drakovdcm.

Redakce - je tu mylenek na cel dal dra slo; jen to vzt za sprvn konec.
Wothan20.3.2003 (13:53)
ARgonaut: setkal...bohuel. Nen na tom nic tajemnho, zvltnho, prost nic - bu je to velmi smutn nebo lhostejn. Kdysi jsme mli jako dti na zahrad boudu postavenou z rakve v kter do R poslali njakho horolezce - ze zinku byla stecha, z bedny (vnj obal do letadla) bouda...ironie. Co se nemrtvch te...taky jsem etl Stockera :-) (a mimochodem nikdo podle mne dosud nedoshl jeho kvalit). Ale nemrtv jsou samozejm zajmav i v tradici - a u Antick nebo stedovk - u ns jsou notoricky znm pohby revenant, ppadn opakovan zsahy na pohbench apod. To nepochybn zajmav je...ale zajmav je to asi hlavn pro to e se to tk lid. Jinak mty jsou zajmav prv pro to e nekaj nic jednoznan, jen naznauj a hrozba je asto pouze tuen....technokratismus RPG a modernho pojet kde eho vetn magie mne nud a nezajm, proto mm odpor i k podobnm hybridnm elovm bastardm.
Fanda20.3.2003 (14:47)
Wothan: na druhou stranu mtus nen mrtv a dle se vyvj ovlivovn tmi, je mtus - co my vme, co se bude vymlet za 100 let a jak pedstavy budou zakoenny v myslch snlk

Darkelf: Ha, ha, nech zan konflikt dvou pedstav! V tv myssli jsou draci evidentn jakoto sstlessnn prodn moc, kter tresst - zejm petaen z evropskch legend, jen dolo k pevrcen rol - drak je dobro a lovk zlo. Jene vem si prv draky Vchodn - ti takhle nevypadali, nebo ne vihni.
Vce v druh sti poudaky:

Draci obou stran budou spojeni pod veden dvou sester - vdem, je dok tvoit a nahlet do sn. Jejich boj vak bude nerozhodn, dokud nepijde ten, je nese bo jmno a vyzbrojen mocnm meem - na jakou stranu se pid, tu posl a ta pak vyhraje.
Zde poudaku konm. Piznvm tak, e nen z moj hlavy - jedn se o "mytologick" podtext mangy s nzvem X od supiny CLAMP a a se jedn o "modern splcaninu", pece jen mne tato mylenka zaujala a tvo krsn pbh a rozhodn ne ernobl - a o krsn pbhy pece jde, nebo ne?
Wothan20.3.2003 (15:11)
Fanda: to je pravda, ale myslm a nechci se tu nikoho dotknout - e zpsob jakm vili nai pedci mtm a to co tu leckdo vyprv o sv ve v cokoli bude diametrln odlin.
argonantus20.3.2003 (15:43)
Wothan:
kdy jsem tohle frum zakldal, uvaoval jsem, zda se mm vnovat takovm problmm, jako dosah draho dechu v szch, typy blesk, seslanch draky a podobn... pak jsem si ekl, e radji zanu tm, co mne opravdu zajm; relnost draka, relnost mtu vbec, vnmn fantastina a tak...
v zsad trpm podobnm primitivismem, jako ty - je-li mtus dostaten uleel (nejlpe z 12. stolet), psob na mne jaksi seriznji (vimni si mho spontnnho vkiku na hermetismu)
sm se pesvduji, e vc asi nen tak pln jednoduch; zle nejen na st, ale tak, JAK kvalitn je mtus zbudovn; Glaurung je zjevn uml vtvor pana Tolkiena, ale to mu nebrn, aby to nebyl v jistm smyslu nejlep drak vech dob a vk...

vnmn mtu dve a nyn - tak zvratn tma, protoe nemme dkazy; ale troufm si mrn nesouhlasit; i tehdy byli mezi lidmi propastn rozdly, a to tak velk, e mon maou rozdly mezi vky; jinak by se na to dval Bernard z Clairvaux, jinak opat Suger a jinak kanovnk Vyehradsk... zkrtka, i tehdy byli lid s mysl otevenou; lid tolerantn; lid, co v naprosto vemu; lid, co nev niemu...
v zsad ale myslm, e jdro pudla je ve stedovkm POSTOJI, e vci zrove jsou a zrove znamenaj - a to klidn vc vc najednou. Dnes pro vtinu lid vci jenom jsou (objektivn realita), nebo jenom znamenaj )psmo, umn). Stedovk mylen se ale zan v dob postomodern zadnmi vrtky vracet... jinak eeno, e jsme dnes otevenj stedovkmu vidn svta, ne doba ped asi ticeti lety... je to jet srozumiteln?
argonantus20.3.2003 (15:47)
Fanda:
opravuji nzor, e jsem byl v minulm ivot Fandou. Teprve dnes jsem pronikl k tv vni pro manga, co je svt, kter je mi naprosto utajen; to je tak dvod, pro se ti zd (zejm prvem), e pehlm a podceuji draky Vchodu. Samozejm o nich vm... a maj tradici mon vt, ne ti nai; ale nemm k nim ten samozejm, blzk a ptelsk vztah, jako k tomu kanovnkovi a Vyehradu; Orient je pro mne tak trochu zhada.

Jenom dluno poznamenat, e tv pedstavy a vn jsou ve striktnm rozporu s tebou hlsanou Fandologi; v takov dvojm svt me t snad jen Japonec.
Wothan20.3.2003 (17:02)
Argonaut: ehmmm...Glaurung nen osobn vtvor pana Tolkiena...a nebo je, to bych mu zase kivdil, ale specieln u tohohle literrnho poinu bych se pozastavil - projdi si Tolkienovu verzi a projdi si mtus o Sigurdu Ffnirbanim. Je to jeden z nejznmjch mt starogermnsk mythologie (podobn jako cel tahle poveden rodinka - Sigmund, Sigurd...Volsungov, Nibelungov). Tolkienova konstrukce je samozejm trochu jin, zasazena do jinho rmce, ale najde tu dostatek a npadn spolench rys, aby bylo mon mluvit o zjevn inspiraci.
Fanda20.3.2003 (18:29)
Argonantus: Pece sis nemyslel, e tu hned na sebe vyklopm, e jsem otaku, ale ty divn smailky mohly napovdt. ~_^

Popravd mj postoj je velmi roubovan - lb se mi snt o dracch, elfech a vem tom okolo a proto nevm tomu, e kdy byli, protoe A) poze uvit je a pli snadn a B) kdyby skuten byli, a my to vdli, tak o em bych pak snil - zkuste snt o idli, na kter sedte - moc dobe to nejde.

A pokud jde o ten Vchod - je to zkrtka jin pohled na tu samou (nebo podobnou) vc, jako je teba drak - a nekm, kter je lep - pkn jsou oba, protoe z obou se daj zosnovat Pibhy a ty evropsk nejsou o nic hor, jen jin.
Lady Candar20.3.2003 (19:06)
Ja se taky hlasim k hrdemu odkazu otaku. ^___^

Ehm... Fanda... ten Fanda? Z manga konfery?
Fanda20.3.2003 (19:58)
Candar, ty zn jinho? ^_^
A abych ti to dokzal - tak dky za stbrn autogram - vak ty v.
Wothan21.3.2003 (9:36)
Snt o idli jsme nezkouel, snt o naich pedcch, o kterch na rozdl od drak a elf mme pln muzea dkaz ale lze...navc snt se d i rukama. A vdycky zstane spousta nezodpovzench otzek, jestli potebuje pro sv snn nejistotu a njak ta bl msta na map. Mn nevad provat Tolkienovy mty ani s vdomm e je to beletrie, co nedovedu pochopit jsou lid, kte se jen s vdomm "pouh" beletrie nesm a krkolom nap vemi klouby lmou realitu do podoby ze kter se sna vydojit alespo kapku nadje, e jejich oblben mty a postavy by mohly stt na njakm relnm zklad. Pijde mi to hloup...ale asi to souvis s Argonautovou tez o tom e vci kter alespo bud dojem relnosti jsou prost pitalivj.
argonantus21.3.2003 (10:09)
Vichni drakovdci:
Wothanovo 17.02 jako reakce na m verej 15.43 mne naped vedlo k banlnmu nzoru, e Glaurung neme bt pvodn, protoe nic nen pvodn; mty se jen tak trochu mn... a tak jsem byl zklamn, e nezabral na druhou plku m glosy, kter mi pipadla dleitj... le zase off topic.

Pak mi ale zaal ten Sigurd vrtat v hlav, vzal jsem do ruky Montse Sainta (zase - taky co jinho; jin drakologick esk kniha, pokud vm, neexistuje); a strvil jsem s tm docela zajmav veer, jeho vsledkem je tento MYTOLOGICK VLOV:

1) Veker dra mty na Evropsk stran, pravm; gravituj ke tem zjevnm archetypm, kter pro pehlednost oznauji I,II a III. Samozejm existuj kombinace a vylepen o rzn detaily... a pokus o keanskou verzi draka - bla, jen se moc nechytla.... viz dle

2) Nafackoval bych si - vbec nevm, pro tu eme otzku starobylosti dra ideje, kdy nad hlavou mme dkaz nad jin; souhvzd draka!!

Obloha byla poprv popsna, slyte, starmi Sumery, nkdy okolo r. 3000 p.n.l., a je to jeden z vbec nejstarch vtvor lidsk kultury (raritou je Orin - ili Uru anna, svtlo oblohy, kde je podoba lovce zachovna i s originlnm nzvem; zejm nejstar vlastn jmno, co vbec existuje...)
Zmny dalch kultur (ekov, Arabov, doobjeven zbytku oblohy v baroku) jsou celkem minimln; nen pochyb, e Drak, kde se nachzela v t dob i nejsevernj hvzda oblohy (Alfa Draconis - Thuban), byl zajist mezi tmi prvnmi...
a nejen to - Drak tvo celek s partou souhvzd Kefeus - Perseus - Kassiopeia - pak tu mme nejstar drakobijnou scnu na svt, a je to zklad Archetypu I, jeho podobu znme z povsti o Perseovi (pravda, jmna jsou eck, a tud vzhledem k asnmu st cel vci relativn znovn... a krom toho drakovi tu konkuruje velryba, souhvzd na opan stran oblohy z jinch verz)- nicmn odtud zjevn kr dlouh ada drakobijc pes eckou Sybaris, toho Sigurda, sv. Jiho a tak Bajaju (specieln pro Frelina...) a konen i Glaurunga a jeho etn potomstvo.

3) jsme-li u u ek, musme u zakrojit do archetypu II - a tm je alchymie (je mi lto - bude to nevyhnuteln trochu okultn; kdo to nesn, a si zakryje oi). Zklad je Egyptsk, odtud se to dostalo do dvou proud - Bible a k ekm; zde pak mme alchymick Nvod, jak to pracovn nazvm, obsaen pln v prastarch mtech o Hraklovi a o Argonautech;
prv ekov do toho vnesli uvn draka jako symbolu... (to je ten ze zahrady Hesperidek, kter je t nkdy povaovn za draka nebeskho (pak pat k souhvzd Herkula), a nikoli nhodou skoro stejnho draka, jen hld zlat rouno...
nedosti na tom - jet je tet slavn drak, t alchymick, toti ten Kadmv, jeho zuby byly zasety do zem... dl pro opravdov znalce viz frum hermetismus

4) v kesanskm stedovku se, pochopiteln, velmi zhy objevil archetyp I (pr drach historek tohoto typu se ve ke Karlu Velikmu, nkter k Artuovi ve star verzi...) a nikdy nevymizel - v m knize jsou tu pkn historky jihofrancouzsk a panlsk, o dracch z Mont Blancu a o drakovi La Vbria...
a derem poloviny 12. stolet a druh kov vpravy do Evropy vtrhla tak alchymie (typ II), aby zaplavila skuten kdeco (namtkou - svat Grl, katedrly, panna Maria, heraldika) - nikoho nepekvap, e se objevily i dra historky alchymick, ne nepodobn tm eckm (n Bruncvk, pr pvodn od Chrtiena de Troyes a jeho Yvaina - mimochodem, tento Chrtien by ml bt prohlen ve fantasy za svatho, hned vedle Tolkiena, neb vynalezl minimln svat Grl a Lancelota...)

5) jene mne vysloven pekvapila sla archetypu III - pln jinch drach historek, ponejvce z Francie, nejmn ze 14. stolet, kter je vysloven erotick... jde toti o mnou a Wothanem pvodn pohrdnutou ideu drakodlaka - tedy draka, kter se promnil v princeznu, nebo v prince, za elem milostnho souit s lovkem... takov ppady jsou Meluzna, Jilocasin, Dra princov a vbec idea zlatho draka...
Ptel, bu to vymysleli Francouzi (to by jim bylo podobn), nebo dokonce Albigent, nebo je to jet star - ale vzte, e v tto vtvi pbh jsou draci zsadn hodn (!), a autorm pjde motiv souit s plazem vysloven rajcovn... a je to napsan tak, e to m nco do sebe (mimochodem, e to je archetyp, dokazuje to, e bez znalosti ehokoli podobnho jsem tento motiv v jednom svm pbhu pouil takk.... a tak nelze nevzpomenout na jednu nejlepch Sapkowskho povdek o zlatm drakovi, t s erotickm podtextem... )

Lady Candar: U tohoto bodu t volm na pomoc - jde mi zrovna do rny! Taky si nco podobnho spchala - mluv, jak jsi na to pila...!

6) Speciln po Wothana: - Sigurd
a Ffni v m verzi se podob Glaurungovi evidentn v postav zrdnho trpaslka Mma... ale to je asi tak cel. Jinak je to v zsad archetyp I. Ovem zase mne zaskoila ta alchymie, kter tam evidentn nem co dlat (drak, probodnut do krku; porozumn ei ptk; hrdina se koup v dra krvi) - to pece mus bt pozdj intoxikace mtem II, protoe ped 12. stolet to nem v Evrop co dlat... jak je valstn Sigurd a Ffni star, Wothane?

A to vechno jen pro rozjet - vynechvm opt Vchod, to je sp pro Fandu... a ty opeen hady - tam plavu taky....
Wothan21.3.2003 (11:42)
Argonaut: ke zbytku snad pozdji, ale co to je "v m verzi Sigurda"? Drak promnn Ffnir - pvodem trpaslk nebo lf, zkrtka sktek (germ. myth v tom nemla nikdy tak docela jasno), t kouzelnk. S Mmirem tenhle mtus vbec nesouvis. Sigurd jej zabil na popud Ffniho bratra Regina - to byl tak sktek, bjn kov kter jedin dokzal skovat peraen Sigmundv me (e ti to nco pipomn?) a to tak e jm peal Sigurd Reginovu kovadlinu i se palkem. Protoe se nemohl Ffnimu postavit elem (kvli jedu kterm by ho zahubil), vyhloubil na Reginovu radu dru do kter se skryl a bodl draka kdy lezl pes ni do jednoho z mla slabch mst. Ffnir ale nezemel hned - ne zemel mluvil se Sigurdem a defakto jej proklel (to je taky vc verze, ale Ffniho poklad skuten nikomu nepinesl tst, jen zkzum a nakonec skonil ve vodch Rna). Sigurd pot sndl jeho maso (nkde jen ochutnal i olzl prsty) a porozuml ei zvat...na udn ptk e Regin kuje zradu jej Sigurd pro jistotu tak zabil, ale Ffniho proroctv se stejn vyplnilo. V tom mtu najde i celkem mlo podstatn, ale zajmav vci - dra pilbu dsu atd. To co povauje za nepodstatnou zmnku je naprosto zeteln a pm Tolkienova inspirace (inspirace se samozejm nerovn slovu opsal) pro svho draka. Jak km - je to velmi znm mtus, stran drak a germ. mythologie snad vbec nejznmj, odbt ho takhle strohou poznmkou si nezaslou :-)
argonantus21.3.2003 (11:57)
Wothan:
no vid - nelituji, e se obracm na pravho germnskho boha... tyhle podrobnosti vbec neznm; a inspirace Tolkiena je tu samozejm mnohem zejmj...
taky potvrzuje moje podezen, e to, co mm j, je jaksi novj adaptace - u tebe chyb to dleit bodnut do krku, i koupn v krvi... porozumn ei zvat a ei ptk jsou dv hodn jin vci, a to vypad, jako skoro tot...(mimochodem, Zlatovlska, e?)

Jet prosm o upesnn stran st; co jsou nejstar rukopisy.... a vbec.
Wothan21.3.2003 (13:06)
Argonaut: zkus si sehnat nkde v knihovn Sgu o Volsunzch (jet by se dali sehnat Ynglingov, Nibelungov jsou u ale o nem jinm - to u je Nmeck klasika a pomrn nov vc - 12.st.). Ti Ynglingov jsou pmo z pera Sonrriho Sturlusona, take njak 13.st. ale defakto pepis mnohem starch mt (spec. Island je v tomhle smru krsn konzervace). Ty Volsungy seene u asi jen v knihovn - v pekladu od L. Zatoila (bo to vylo 1960). Taky je to peklad ze star islandtiny (defakto star Nortina) - tyhle mty maj dost obtnou dataci, protoe zpis je obvykle pozdj a pedchzelo mu nkolik stalet stn tradice. Mtus o Volzunzch a Nibelunzch odkazuje a ke dvoru krle Budliho (Attila Hun, n oblben Bi Bo) a odr se v nm ozvna skutench udlost stran vyvradn kmene Burgund. Ale i dvr Budliho v tchto mtek u je tranformovn do podoby Viking (v Nibelunzch to u vbec psob trochu legran...tedy ne samo o sob, to jist ne, ale v kontextu historie nesporn) atd. Take a takhle daleko ty mty sahaj, ale zznamy jsou mnohem pozdj - nejstar fragmenty obvykle tum kolem 9-10.st. Kdy jsme u toho peraenho mee, to je tak mj oblben mtus, protoe odkazuje k jinm archetypm - ten me se jmenoval Gram. Dostal ho Sigurdv otec - Sigmund (Nmci kaj Sigmundovi Siegmund a Sigurdovi Siegfried) pmo od boha Odina - ten se zjevil na hostin (nepoznn jako obvykle - vtinou se zjevoval v podob jednookho vysokho starce v modrm plti) a zarazil tento me do trmu s tm e kdo jej vythne tomu pat (a nejen ten me). Jedin Sigmund ho vyjmul bez jakkoli nmahy z trmu. Byl to me ukovan sktky, nezniiteln vtzn zbra. Pesto jej zniil zase Odin kdy se postavil do cesty Sigmundovi v bitv, ten jej nepoznal a al - Odin nastavil sv kop a Sigmund o nj me perazil. Tady je velmi zajmav srovnn s Wgnerovou verz v Prstenu Nibelung - je to zcela jinak. Po Sigmundov smrti jeho ena uchovala lomky mee Gramu aby je pak Regin znovu skoval dohromady pro Sigurda....tady m Tolkienovu inspiraci, ale asi to nebyla jedin inspirace. Nicmn je to zjevn tak urit archetyp - tenhle mtus i sp jeho koen znme v mnoha rznch podobch - viz. keltsk Caliburnus (Excalibur). Mtus o legendrnm mei kter pivede krle k vtzstv zn snad cel svt - tum e nco podobnho znali teba i Mongolov.
argonantus21.3.2003 (13:12)
Wothan pro mn dost sloit, ale nadmru uiten:

1) Pochopil jsem sprvn jdro t trajektorie:
Argonaut: zkus si sehnat nkde v knihovn Sgu o Volsunzch (jet by se dali sehnat Ynglingov, Nibelungov jsou u ale o nem jinm - to u je Nmeck klasika a pomrn nov vc - 12.st.). Ti Ynglingov jsou pmo z pera Sonrriho Sturlusona, take njak 13.st. ale defakto pepis mnohem starch mt (spec. Island je v tomhle smru krsn konzervace). Ty Volsungy seene u asi jen v knihovn - v pekladu od L. Zatoila (bo to vylo 1960). Taky je to peklad ze star islandtiny (defakto star Nortina) - tyhle mty maj dost obtnou dataci, protoe zpis je obvykle pozdj a pedchzelo mu nkolik stalet stn tradice. Mtus o Volzunzch a Nibelunzch odkazuje a ke dvoru krle Budliho (Attila Hun, n oblben Bi Bo) a odr se v nm ozvna skutench udlost stran vyvradn kmene Burgund. Ale i dvr Budliho v tchto mtek u je tranformovn do podoby Viking (v Nibelunzch to u vbec psob trochu legran...tedy ne samo o sob, to jist ne, ale v kontextu historie nesporn) atd. Take a takhle daleko ty mty sahaj, ale zznamy jsou mnohem pozdj - nejstar fragmenty obvykle tum kolem 9-10.st. Kdy jsme u toho peraenho mee, to je tak mj oblben mtus, protoe odkazuje k jinm archetypm - ten me se jmenoval Gram. Dostal ho Sigurdv otec - Sigmund (Nmci kaj Sigmundovi Siegmund a Sigurdovi Siegfried) pmo od boha Odina - ten se zjevil na hostin (nepoznn jako obvykle - vtinou se zjevoval v podob jednookho vysokho starce v modrm plti) a zarazil tento me do trmu s tm e kdo jej vythne tomu pat (a nejen ten me). Jedin Sigmund ho vyjmul bez jakkoli nmahy z trmu. Byl to me ukovan sktky, nezniiteln vtzn zbra. Pesto jej zniil zase Odin kdy se postavil do cesty Sigmundovi v bitv, ten jej nepoznal a al - Odin nastavil sv kop a Sigmund o nj me perazil. Tady je velmi zajmav srovnn s Wgnerovou verz v Prstenu Nibelung - je to zcela jinak. Po Sigmundov smrti jeho ena uchovala lomky mee Gramu aby je pak Regin znovu skoval dohromady pro Sigurda....tady m Tolkienovu inspiraci, ale asi to nebyla jedin inspirace. Nicmn je to zjevn tak urit archetyp - tenhle mtus i sp jeho koen znme v mnoha rznch podobch - viz. keltsk Caliburnus (Excalibur). Mtus o legendrnm mei kter pivede krle k vtzstv zn snad cel svt - tum e nco podobnho znali teba i Mongolov.
Fanda21.3.2003 (13:16)
Ad Wothan 21.03.03 09.36:
S tou druhou polovinou se zcela ztotouji.
A pokud jde o to snn - ekl bych, e opravdu zle na tom, kolik toho o danm tmatu dan lovk v - jak bych ti to jen - podvej, teba ty, nebo Argonantus mete nakrsn snt o dinosaurech - j u ne. Byvi lovk biologicky vzdlan (ach jo, co tu jet na sebe nenaprskm ^_^), je tohle pro m u formulovn hypotz a to je u nco kapnek jinho.
Ono ani dost nejde snt o dob naich pedk - piznejme si na rovinu, e dn med to tak nebyl - pna, mor, cholera, drancovn, prvo trpn, atd. - snt se d jen o tom, jak by to bylo, kdyby, ...
Ale dosti u toho, protoe se obvm, e bysme skonili u toho, e kad mme pojem "snn" nadefinovn trochu jinak.

Argonantus: no tak ti dkuji - te abych otevel ty Mty a legendy a Pbhy drach csa znovu, protoe u je to njak ten ptek (sobota, nedle, ...), co jsem je etl a bohuel na to v souasn dob as nemm - ledae byste tak 2 msce vykali.
argonantus21.3.2003 (13:22)
Do pytle, te jsem to zkazil.

Wothan jet jednou:

1) plat, e naped Budli (Burgundsko), pak Yngligov (island, asi 9. stolet), pak Volslungov (10-11. stolet) a pak Nibelungov (12. stolet), a pak teprve dochovan zpis?

Cel, co vyprv, nese rz urit dmyslnosti a sloitosti - asi to zase tak pln star nevypad (12. stolet?)

2) Me sice nesouvis s draky (i kdy ne tak docela - mtus skvlho mee pat k drakobijci dost asto), nicmn i zde jsi mi dost pomohl - da se ti nechtn oddlit pedalchymickou verzi povsti
tohle mne toti vdy mtlo - me v kameni (v trmu, v kovadlin, atd.) nese asto jasn odkazy na Mojovu hl; zejm jde ale o dv rzn vci, kter se teprve v barvitm 12. i 13. stolet spojily....

4) Mongoly neumm - i kdy jsem se jimi nedvno dost zabval (kupodivu v souvislosti s RPG), neb jsou asn zhada (pro vlastn nerozdrtili roku 1241 Evropu? My to vysvtlili v t he ist fantasticky - hrdinov ukecali na pomoc draka Nigreona, aten jim pomohl Mongolm namltit... ale to odbouji, jen pro poten Frelina, S.U.P.a a dalch).
Wothan21.3.2003 (13:24)
Fanda: pijde na to co rozum pod pojmem "snt" - ano romantick snn zamilovan estnctky bude o nem jinm ne nae non mry :-) Jak bych to jen ekl tob - my co vme (se v rezervou kter se do slova "vdt" vejde) snme jak se tomu piblit, ale prv pro to e vme, mme pedstavu co to obn. Mon jsem masochista, ale snn nemus vdycky provzet rov mlha a romantick pedstavy :-)) Se vztahem oboru k fantasii souhlasm - poznatky a znalosti pistihuj kdla fantasii v kadm oboru.
argonantus21.3.2003 (13:38)
Fanda a Wothan jet jednou:

u mne je to zase obrcen. To, o em nevm lautr nic, o tom nemohu snt (manga, Ynglingov). O tom, o em vm dost, to mne naopak svd k pemlen, v krajnm ppad a k umn. ivot na hranici relna a nerelna je mi druhou pirozenost; nutnost je ovem byste navigovat v rznch odstnech relna, aby lovk nezmagoel pln...

nejde, o to, e vm o vci moc; jde o to, e jist vci nemaj to, co nemohu nazvat jinak, ne jist magick nboj; dui; vak vte, co myslm. V tom je problm Fandovy teoretick idle; je naprosto jasn a nen na n nic zajmavho; kdyby kad, kdo na n sed, zmizel, nebo zmoudel, nebo tak nco, to u by bylo nadjnj...

Kdyby byla na svt jenom ist vda, svt by byl hrozn otrava; srovnejte obraz 12. stolet ve va koln uebnici djepisu, a mj obraz kanovnka s drakem...
Wothan21.3.2003 (13:41)
Argonaut: ten mtus mee v kameni, trmu i kovadlin je skluten velmi star. Co se te zznam - prvn zznamy (alespo v germ. oblasti) jsou dost pozdn - 9-10.st. Je teba si uvdomit, e v germnsk pohansk oblasti neexistovalo psmo - runov zpis se nepouval k bnm zznamm (vjimkou je teba zkonk v Codexu Runicu) a ani to nebylo teba - skaldsk tradice stla pedevm na stn form (ta forma sama o sob je dost komplikovan - je to sms mnemotechniky pro uchovn a reprodukci a umleckho stylu). Proto se nejstar podoba mtu obvykle nedochovala - pokud byly zznamy obvykle byly ztraceny nebo se dochovaly pouze ve fragmentech - je to cel ada sg. Snorriho zmnn zznamy jsou pozdn (podobn jako jeho mlad Edda), ale na Islandu petrvala bez vtch vnjch vliv konzervovan tradice (a peila i pechod na kesanstv) skaldsk poezie - vetn zmnnch sg a mt, take zaznamenan mty maj podstatn star koeny a asi ani nijak dramatick obsahov zmny. Ale njakou promylenost bych v tom nehledal. Nibelungov jsou jin ani ne tak pro to e jsou z 12.st. (to jsou Snorriho zznamy i mlad), ale sp proto e pochz z jin kultury. Autor Nibelung vychzel z pvodnho strohho mtu, ten kompletn pepracoval a zapsal ve stylu obvyklm pro styl tzv. "rytsk kultury" (poezie). Vechny postavy dostaly tak nov ntr, dlo bylo pevedeno do soudobm a znan idealizovan podoby, poty inkujcch asi zdesateronsobeny...ve je podan ve velmi nadnesenm duchu (la Kolkovo inkuje tisc slon) ve zjevn snaze ohromit posluchae. Motivy a jednn lid jsou upraveny tak aby odpovdaly soudob dvorsk kultue a pesto z toho stle vykukuj pvodn motivy kter do takovho dla njak nepat...relikty...dost, srovnvat tyhle dv verze mtu by dalo na tlustou a nezivnou knihu :-)
argonantus21.3.2003 (13:46)
Wothan:
ale jo, tady zhruba rozumm. Dovoluji si srovnat sesterskho Artue (pvodn verze, boj se zlmi Dny), a rozenho Artue by Chrtien de Troyes (vetn Lancelota, Grlu, pvodu z Trje atd.)

Zvlt mne zajm nejstar mon verze Sigurda (to je to, cos vyprvl?)

Jinak, co ty na Archetyp III - tu drakodlakoidn verzi? Maj Germni taky nco takovho?
Wothan21.3.2003 (14:00)
A k Mongolm (omlouvm se za OT) - to je velmi prost - Vpd do Evropy vedl Batu Chan. toili ve dvou proudech a jejich rychl postup byl zpsoben jednak taktikou - pekvapen, rychl pohyb pevn lehk jzdy, stelci, vborn vojensk organizace. Taky se v prvnm plnu nezabvali dobvnm pevnost kter nezskali nhlm pepadem. Jene jeden proud thl pes Polsko - roviny, niny, ideln. Druh proud podobn napadl Maarsko. Jet 1241 porazili Mongolov u Legnice Jindicha Pobonho a Temple (tuhle bitvu jsme spolen s kolegy z Nmecka provihli...mon e je to dobe). Doln proud narazil na tvrd odpor, proto mu ten Polsk vyrazil na pomoc - take Mongolov prothli Moravou. Ale protoe nemli as sp jen zbn spovali napadni posdkami hrad kter se ani nepokoueli dobvat. Co je koda, protoe pokud by oblhali hrady v naem lenitm ternu mohli bychom se dozvdt vc o adaptabilit jejich taktiky...na druhou stranu je otzka jestli to je takov koda, jsem rd e nemm ikm oi. Ten severn proud se jet dokzal spojit s jinm a porazit uhersk vojsko. Spolen pod Batu Chanem pak mli vst der na Rakousko. Fridrich Bojovn u byl nahaven na hranicch a i Vclav stahoval co mohl na jin Moravu. No a pak prost jednodue zemel Velkch Chn Ogodaj a bylo po ptkch. Batu Chan se otoil na pat, s nm se na pat otoila cel mongolsk armda a vyrazil dom protoe bylo teba eit problm nstupnictv a tak star Ogodaj, tm e nathl sv perka ve sprvn as zachrnil Evropu....akoli je otzka jak rychl by byl postup Mongol dle do nitra Evropy ve stle horch podmnkch a pedevm zda by vbec dokzali dobyt zem efektivn ovldnout a udret....konec hist. exkurzu...jak kaj tatai - Kesim! :-)
argonantus21.3.2003 (14:10)
Wothan:
j to tady nechci rozpatlvat s tmi Mongoly... ale mn tahleta oficiln verze moc jasn nen; vykazuje nkolik podivnost; ta smrt Odadaje mne z rznch dvod nepesvduje jako dvod k tomu, aby zapchli oslniv spn taen v nejlepm...
Batu a po nm Barka nemli anci na vrchn velen; taky ho ostatn stejn nedostali; asov prodlen en udlost po ploe e je dal zhada; e u se stejn pomalu rozpadala; nebylo by jednodu dojt ten mal kousek k ocenu (po bitv u Lehnice a Saj se stelnm prachem...), a pak si v klidu eit nstupnictv...?

Ale asi to nevyeme; nechme ofiiln verzi.

Co ti sexuln draci z Francie?
Wothan21.3.2003 (14:29)
To taen bylo oslniv spn sp v potku a to z velk sti stlo na momentu pekvapen. Kdyby severn proud thl dl k ocenu, byl by jin proud pravdpodobn poraen, protoe odpor na jin front byl mnohem silnj ne velmi spn Polsk akce. Na jihu by se mohli dostat mezi Uhersk a Fridrichovo vojsko i za pedpokladu, e bychom se toho neatnili my, protoe pi dalm taen na Nmecko by musel Vclav dret pedevm severn hranici ech. Batu Chan by mohl ztratil pl armdy, bylo nezbytn nutn aby severn proud sthl do Uher (alespo to je mj nzor). Take o pokraovn po severn linii dl k ocenu neme bt e. Probjewt se dl pes Rakousko, echy a Nmecko by je stlo hodn sil a veker moment pekvapen u byl dvno pry. I kdyby dokzali porazit zbytek Evropy nedokzali by ji udret. Hdm, e Ogodajova smrt byla prost posledn kapka.
Wothan21.3.2003 (14:30)
Sexuln draci Francie mi moc nekaj :-)
argonantus21.3.2003 (15:00)
Wothan:

ned-li pokoj, budeme muset zaloit vlastn frum... na jihu v bitv u Saj podle mne probhl naprost debakl Maar, pr dn od t Lehnice; podle mch zprv byli Maai z hlediska vojenskho prakticky vymazni z mapy (jet o rok pozdji si vesele Mongolov hospodaili nkde v Dalmcii); jin armda Mongol musela bt velk, jako prase (nenapad mne lep vraz - mluv se o 90.000 Mongolech, sloench pvodn ze dvou proud); k tomu se pisypala pez Moravu ta severn armda (od zatku men- 30.000 podle pesimist), take nkdy v dubnu stoj proti spojenmu vojsku Vclavovu a Fridrichovu asi dvoj - a trojnsobn pesila Mongol, nkde v oblasti Vdn (kdovpro se tolik dleitch bitev odehrlo tady); za nimi je na Dunaji, vedoucmu do Nmecka, u jen pr pevnost (Salzburg), kter mon psob impozantn na stedoevropany, ale proti zplav Mongol se stelnm prachem a raketami je to sp sranda (kdy vzpomeneme, jak snadno zatoili s Kyjevem... i s tou Lehnic...a Krakovem... a kdy uvm, jak debil byl arcibiskup Sponheim...); navc e si stle jet laskav nevimla, e nastal prv konec svta (co by asi tak provdl Fridrich II, kter ml prv nkde v neapoli pln jin starosti?)...
Mn to pijde sp achmat z hlediska Evropy....
argonantus21.3.2003 (15:22)
Projevuji trval zjem o sexuln draky z Francie a astronomick draky zejm starovk... viz 21.3. rno
Wothan21.3.2003 (15:28)
Tak to se u asi nedovme. Pokud by si vyloen vili nechpu pro stahovali severn armdu na jih a spojovali oba proudy v jeden. Pravdpodobn pro hlavn der a ten by el na Fridricha....nebo v horm ppad na Moravu a pak na ns. U e bych se bl sp o to e ve sv rozdrobenosti by nebyla sto se inn a efektivn brnit (sp vas). Pesto si nemu pomoct - i kdyby se probili Evropou (taky by znan prodli) i kdyby dobyli vechny pevnosti v cest (i se stelnm prachem by ztratili dost asu a rozhodn moment pekvapen), nebyli by ve stavu vldnout Evrop ani ji celou zniit.
argonantus21.3.2003 (15:36)
Wothan:
Jo. Ale s tm si moc nelmali hlavu... alespo v ppad jinch zem... z Polska a Uherka tie vym,izeli do nkolika let, z Ruska za dvst let, z ny za sto let... j fakt nevm...

Te jsem objevil manka na hlavn strnce (koment lnku o dracch), kter tam tvrd, e Slovani znali draky tak... tak tohle mi pln uniklo - vdy se naopak poukazovalo na znan nedostatek drak v Rusku a okol...
Fanda21.3.2003 (15:39)
Argonantus: A pro si mysl, e se ve chvlch volna bavm o dracch a spolench jevech ^_^

Ad. ti Mongolov - ale berte to prosm jako plcn naprostho laika: Vdli vbec, e jet kousek a maj na dohled ocen? Krom toho, nm me znt nutnost vrtit se po skonu panovnka z spnho taen jako blbost, ale na druhou stranu, my nejsme Mongolov.
A jen tak na okraj - nkterm z ns by ikm oi ani tak nevadily ^__^
Krom toho i tak zde rzn asijt njezdnc zanechali sv geny - uvidte-li nkde dvku s dlouhmi vlasy a k pasu i dle, pak je tm jist, e jej praprapra....babiku znsilnit njak Asiat.
argonantus21.3.2003 (15:42)
Fanda:

Jo. A jet nm dlu vhled do nitra ikmookch drak... nebo alespo nhodn vedenou sondu; to bv tak zajmav.

Jinak - ty bys zrovna mon vdl nco o tom souhvzd draka...
Wothan21.3.2003 (15:44)
Fanda: no to sice zanechali, ale ne pmo Mongolov-Tatai - sp jejich pedchdci Avai a ped nimi mli Slovan co do inn i s Huny, ale to se ns tady a tak dalece netk, kdeto ti Avai nesporn ano. Jak podl v genetice zanechali si netroufnu tvrdit - to je sp tvoje odbornost, ale teba refelxivn luk jakkoli se tu pouval mn byl jejich ddictvm stejn jako hroty p nasazovanch na ap (to je obecn asijsk zleitost a je zvltn e se nad tm mlo kdo pozastavuje).
argonantus21.3.2003 (15:48)
Potenciln dleit:

nemohli vnst Mongolov na scnu vchodn draky? Pokud vm, mli je vyobrazen na raketch... j snad nkde najdu popis jejich pyrotechnickch stroj od Lehnice, mm pocit, e to s draky souvis...
a vzpt Marco Polo a jeho konkurenti... nemohlo dojt ke kontaminaci nskmi draky u zde...?
Wothan21.3.2003 (15:53)
Stroje? J mm k Mongolm pouze dla, runice (velmi podobn naim pozdjm muketm) a u raket pouze jaksi koe na hromadn vypoutn raket - jaksi primitivn raketnice. A samozejm klasick vahadlov praky. Ale njak velk raketov rampy jsem nevidl.
Wothan21.3.2003 (15:59)
Jo, ale mohl bys mi pomoct s nm jinm - m nkde detailn nkres pu s p횝alkou?
nojon Debe21.3.2003 (16:06)
Wothan: Mno, ten mm, ale bohuel ho nedostanu na pota.
nojon Debe21.3.2003 (16:26)
Wothan: p s p횝alkou - je mi znmo, e pskajc py byly dvojho typu - ptalka ( lo o jakousi malou kouli tsn pod hrotem s otvory, tak aby za letu vydli pskav zvuk ) umstn pod hrotem pu nebo hroty s otvory tak, aby pskaly ( jde pak o vcelku zvln hroty, kter se rozchzej do dvou mench jako roznoka )
nojon Debe21.3.2003 (19:04)
Njak jsem tu propsl ty Mongoly, trochu se k nim jet trochu zpodn vrtm.

Rychl postup - Vcelku zajmav fgl. Zhruba dva dny ped hlavnm vojem jelo nkolik rychlch jezdc/vyzvda. Za vojskem krom zsobnch oddl, dobytka a tak dle, hnala se i stda kon. Na kadho vojka pidali zhruba 2 - 3 pepahac kon. Zvdov pak v ppad poteby dvaly signly k vmn kon. Cesta se tak dala zkrtit a na polovinu. Oekval-li tedy neptel vojska za 14 dn, byl asi pekvapen, kdy dorazila za 7 dn. Bhem nonch pochod se vyuvala dlouh kop coby podpra jezdc. Na konci kop byla smyka, kter se pehodila pes piku boty ( tradin mongolsk boty - gutals, zimn pak boitog ) maj zvednut piky, aby zbyten nekopali do zem ) a kop se opelo o rameno jezdce ped vmi. Mohli tak odpovat za jzdy a nezdrovat se s pestvkami na spnek.

A svte div se - zkladn jednotkou mongolskho vojska nebyl lehkoodn jzdn luink. Lehk jzda ( oblkala bud klasick mongolsk odv "dl" rznch typ nebo vesty z ovch k aj., vyzbrojena byla pouze avl, lukem a py a lasem ) slouila v zsad jako poslov, zvdi nebo pro typickou mongolskou taktiku - lehk jzda pedstrajc tok a provokujc neptele stelbou z luk lkala neptele ke svm oddlm. Tvoili je pevn mlad chlapci a byli to prvn vojci, se ktermi se neptel setkal. Zkladnm jdrem mongolskho vojska byl tkoodn jezdec a v celkovm pomru jich bylo mnohem vce ne lehkoodnch jezdc. Vstroj i vzbroj tkoodnch jezd je pak kapitola sama o sob.

Mme-li bt upmn - Bt-chn ml ance za sv zvolen kaganem pomrn velk ance. ingischn u ped svou smrt sepsal jmenovan Bt-chna Dichangirem. ingischnovo usnesen kdo bude Dichangirem bylo utajeno a do doby taen na Rus. Velkm sokem mu byl chn Gjk syn godajv. Kaganem se nakonec stal prv chn Gjk, kter ovem pomrn brzy zemel. Dalm kaganem ml pak bt Bt, ten se vzdal titulu ve prospch svho ptele Mngkeho a sm se usadil na Rusi ( potek Zlat Hordy ( ta se pak rozpadla a dal hordy - Bl horda... ), zaal tm tak rozpad jednotn mongolsk e na nkolik samostatn fungjcch stt, asto proti sob bojujcch - zejmna Zlat horda s lchn a poslze Timurovci ). Vzhledem k velk rivalit obou chn ( Bta a Gjka ) by byl pochopiteln takov tah ze strany Bta a e se zaala rozdlovat a po smrti Gjka. Navc zde byly pokyny z ingischnovy "Jasy", pikazujc po smrti kagana zanechat boj a na kurultaji zvolit novho. I za takovou dobu mlo jet ingischnovo slovo velkou vhu ( ale s odstupem asu se na Jasu tm zapomnlo ) a Mongolov byli ( a jsou ) nrodem velmi povrivm ) Ovem to je na del a mnohem sloitj debatu, nebo zde pak vysvtaj i dvody taen a s tm i spojen lhostejnost k dobyt Evropy a tak dle.

V udren Rusi, ny a Evropy je podstatn rozdl. Evropa, a men ne Asie, je kontinentem plnm jednoho sttu vedle druhho, navzjem vce i mn si vojensky pomhajcm, pln hnusn politky. Udret takovou jednu zemi v Evrop by bylo tm nemon - krom samotnch obyvatel dan zem budou otravovat a podmannm vydatn pomhat okoln zem. Navc psun vojk do Evropy by byl znan problematick. Co se te Rusi - s odstupem asu Rusov proti panujcm Mongolm nemly vhrady. Zem byla po dlouh dob jednotn, Mongolov Rusm poskytovali vojenskou pomoc a chrnili je. dn vt povstn proti podmanitelm nevznikala. Opakem je na, kde museli podmaen obyvatelstvo velmi asto vojensky krat. Navc v Asii neexistuje, e by nap. Chrezm v dob kdy Mongolov dobvali nu, poslal svou vojenskou pomoc. Kad zem bojovala sama za sebe. Ale to je zase na del diskusi.

e by Mongolov vnesli na scnu vchodn draky? Nepijde mi to jako moc pravdpodobn. Vojska astnc se taen do Evropy byli vojci pedevm z dobytho Chrezmu a Kipci. Tedy vojci odn ve zbrojch spe ve stylu podobnmu Chrezmu ( muslimskmu ) a po dobyt Rusi, Rusm ne n s prvky drak. Na druhou stranu naprost absence nskch znak tak nen moc pravd podobn. Jinak draci byli vyobrazovn na toulcch, pouzdrech na luk ( saadak ), pilbch, pehozech pes kon pod sedlo, nevm o ttech. Pokud se dostal vchodn drak do Evropy prostednictvm Mongol tak nejspe z tchto vyobrazen. A co te raket v palnch zbran se moc nevyznm, ale jestli myslte to stejn jako j ( rakety ). Rampa tvoen dvma devnmi podprami ( tyemi ) s vidlikami na konci, do kterch je zasazena dal ty. Ve vsledku to vypad jako k opkn prasete. Na to jsou naskldny kop nejspe stejn jako se pouvali do dl vypoutn pomoc stelnho prachu ( fungujc jako dnen zbavn pyrotechnika ) Konce jsou na zemi jet podepeny dal ty. Njak m nenapad kam by tam el zobrazit drak.

Potek taen Mongol do Evropy ( podle mch zdroj ). Taen se zahjilo temi proudy
1)Bt ( Subudaj-Bagatur, ejbani, Buruldaj ) s oddlem 300 000 jezdc zamili do Halie a pak do Uher.
2)Bocheton, Kadan, Buri s oddlem 30 000 jezdc pes Podol do Sedmihrad a Moldavie.
3)Bajdar, Kajdu, Ordu s oddlem 270 000 mu thl do Polska.
O tomto rozdlen vypovdaj listy rnskho palatina Otty a csae Friedricha II. ( )
Cel ta kapitola Mongol v Evrop je opedena sammi pro, nevyeenmi otzky, zhadami. Je to pln spekulac a dohad, asto nepodloench, vrcholc v porku Mongol u Olomouce a Hostna to je u zhada jako kruhy v obil.
nojon Debe21.3.2003 (20:03)
Wothan: Dval jsem se po tom detailnm vyobrazen pu s ptalkou, ale nenael. Asi si to u nkdy vidl, tak nevim jestli to nen zbyten, ale pokusil jsem se o jaks taks nrt - http://sweb.cz/nojonDzebe/arrow.jpg
nojon Debe21.3.2003 (20:41)
Jet k tomu mtu o legendrnm mei - myslm, e to se ve k Hunm a Attilovi.
Wothan21.3.2003 (22:12)
Nojon: k Attilovi taky - i v pomrn podprmrnm filmu na tohle tma to najde :-) Je to tak znm mtus e skoro odkazuje na njak archetyp.
nojon Debe21.3.2003 (22:12)
Ted se na to dvm, ach ty poty - u tetho oddlu, kter thl do Polska jsem se spletl o 100 000 jezdc, m tam bt 170 000.
Wothan21.3.2003 (22:19)
Nojon: zkouel jsem ty otvory posadit kolmo na dk aby to pskalo podobn jako kdy psk na lahev, ale nefunguje to. Tak experimentuji dl. Tu kouli znm taky jen od vidn, ale nevm jak pesn to vypad v detailu.
nojon Debe21.3.2003 (23:07)
Wothan: Jsem v tomhle jenom teoretik. Ale peci jen jsem nco nael, i kdy ti to asi nepome - http://www.krackow.com/images/whistle_arrow.gif - jde o jinou verzi p횝alky, osobn jsem tenhle typ vidl pomrn men. Ted si zhlavy nejsem jist, ale mm pocit, e pro tu p횝alku bude poteba speciln hrot, tak aby vzduch pes nj a pes p횝alku pskal. Sp znm samostatn hroty, aby pskaly. Byly dlny z kost s potebnmi otvory, z mch materil jsem napotal asi 30 typ hrot.
Argonantus22.3.2003 (10:13)
nojon, Wothan:
geniln - to nojonovo vysvtlen. Take ns vlastn zachrnil posmrtn ingizchn svm nazenm....!
pokud nkdo chce, mohu mu zaslat svj rozbor boje v Evrop (vedlej vsledek RPG hry - ona je to vlastn taky mlem living history...)

vichni -
ale nyn, pravm, vm, jsou zde Draci - a vy se svmi dmyslnmi vynlezy odejdte nkam k ermu, nebo zalote mongolsk frum!

s jedinou podstanou vjimkou:
polsk kronik Jan Dlugosz popisuje v bitv u Lehnice, e "Mongolov pr vyzvedli na tyi do vky dra hlavu, kter chrlila na polsk vojsko ohe, dm a smrad..."

Hele! Tenhle drak skuten chrlil ohe! Nen ten svt asn?
pece jen to mongolsk intermezzo k nemu bylo...
nojon Debe22.3.2003 (12:34)
argonantus: ingischnovy pokny v Jase jsou nesporn a v otzce nhlho staen Mongol z Evropy hraj svou roli. Otzkou spe je, jakou mly v dan situace vhu a nakolik k stupu Mongol pisply.
Urit mi poli ten rozbor, rd si to petu.
Nem u toho cittu z kroniky i vysvtlen, co to bylo za zbran? Moc mne nenapad co by to mohlo bt. Snad vahadlov praky se lc vrhajc ndoby s vbunm obsahem, na kterch by byly zobrazeny dra hlavy. Rameno by tak vyzvedvalo do vky dra hlavu, doutnajc a pi dopadu chrlc ohn.

Wothan: Nem vyobrazen, popis tch mongolskch dl, raket a runic?
Wothan24.3.2003 (8:33)
Nojon: mm, ale nco je dost nekvalitn - kdytak ti to nascanuju a polu, kdy pole adresu kam to chce, ale nejsem ani trochu rychl. Nebavili jsme se o tom u kdysi dvno?

BTW: dky za upesnn tch pot, j jsme si bh v pro vdycky myslel e severn proud byl vt.
argonantus24.3.2003 (8:46)
Pod vlivem Wothan jsem se zahledl do severskch balad... a co nevidm:
Drak je tu dost astm aktrem (zejmna v Norsku), co asi nikoho nepekvap; co mne ale pekvapilo velmi, je to, e draci se s dmami chtj vtinout OENIT, nikoli je serat... nkdy k pramal radosti dotynch dam (a ty si na n zjednvaj lidsk zabijky), jindy se drak mn v prince...
e by vliv Francie?

Jinak - trochu jsem byl nucen zmnit nzor na ty ohnstrjn draky. Mon to nen jen vmysl prost. Ten uml drak od Lehnice je jeden z pklad... je tu zejm souvislost s ohnivmi zbranmi i s Wothanovou srou.
Dal monost je prost omyl - lze si splst jistou alchymickou vodu s ohnm...
Wothan24.3.2003 (8:58)
Oni si sevean nikdy moc nelmali hlavu s technikou - nkde jsou ti draci jen jednou z nkolika podob urit bytosti a protoe mezi nimi nechyb lidsk je to technicky mon, jinde se tm prost nezabvaj (vn by mn zajmaly jejich pedstavy - myslm tm ist technick - o ken druh :-) ) - konen co chtt od nrod, kter vili e bh Heimdall m nkolik matek (snad 8?...zapoml jsem).
nojon Debe24.3.2003 (9:21)
Wothan: Poli to na poor_hero@centrum.cz, dky moc. Pokud si dobe vzpomnm, tak jsme se bavili jedin o Skotech.
argonantus24.3.2003 (9:29)
nojon Debe:
nezlob. tady jsou draci.

Wothan:
u mtu jde sp o podstatu, ne o technick proveden. A v zsad by poslouilo k archetypu III asi i jin monstrum, ne drak (princip Krsky a zvete - to je zase to sam). Nicmn drak je nestvra par excellence, take pro ne rovnou drak...

poznmka na okraj - nenachzm na dvnm severu jedinho ohnstrjnho draka. To ve je voda na mj mln - ohe se spojil s draky nkdy okolo roku 1200 nejdve, mon i pozdji.

Tak mne napad... pro je vlastn drak nestvra par excellence? Chpu, pro je krlem zvat lev (jindy tygr nebo medvd); pro je ale drakovi piena ato mlokdy zpochybnn suverenita mezi vemi fantastickmi bytostmi? A to plat a po prakticky vechny souasn RPG, vetn toho S.U.P.ova HoMaM...
Wothan24.3.2003 (10:18)
Argonaut: nejsou tam - i ten Ffnir chrlil pouze jed.
argonantus24.3.2003 (10:29)
Wothan:
no prv - stejn, jako vichni jeho ohnprost kolegov.
Jedin podezel vjimka je jedna nedatovan verze Tristana a Izoldy (snad nejsloitj mtus ze vech), kde toho prvnho Tristanova protivnka nahrazuje drak, a Tristan mu naped uhas ohe pomoc mchu s vodou... pak se z toho vyvinulo nco jako Zlatovlska (co je urit pvodn jedna z vtv Tristana). Ale ani tahle vc nevypad star, ne tak 13. solet, nen-li jet pozdj...

moje otzka - pro je vlastn drak krlem fantastickch potvor - trv; njak mne nenapad vysvtlen...
Wothan24.3.2003 (11:09)
To je otzka - je velk, nebo obvykle bv velk (akoli teba v eck ikonografick tradici nijak velk nen - zvten stedn postavy - nap. sv Ji toho draka celkem umenuje), nesporn je nebezpen, nen snadn ho zabt (pevn krun, ppadn nezraniteln tlo a na njak ty slabiny aj.), obvykle bv okdlen a dostat tohle monstum do vzduchu tak by tak nepochybn bylo krlem oblohy (kde by byla orlice...by i dvojhlav?) a i bez ohn to je velk tlama pln zub, spry a velmi asto jed nebo alespo otrven dech.
darkelf24.3.2003 (12:09)
Darkelf: assi vm narum sstrukturu, ale

Kosstn draci, lichov: Nen znmo ani ve fantassy ssvt, e by exisstoval tak mocn Humn, kter by ssvoji myssl ovldl myssl Dra. To sstejn plat i o dui. Je to ssice jeden z nejvtch nekromantsskch ssn, ale sspoutat tak ohromnou a divoukou sslu, kter pat prod nelze. POkud sse to vak poda, Drak ssvou moudrosst a magii donut Nekromanta k lensstv a ssebeznien.
To sstejn plat nepochopiteln i pro bohy, i ti nekromantt nemaj nad mrtvmi draky moc.
V Podtemnu sse vyprv, e exisstuj Dra kulty, sspolek Hmn a jinch tvor, kte sse ssna zsskat abssolutn nessmrtelnosst pro ssvho pna, Draka. Tito draci pouij jejich sslu a magii a za pomoci tajemnho ritulu sse promn do sstdia rozkladu, vznikaj Dra Lichov. Po ssmrti sse vnitn magie koncentruje v kosstech (tud menm objemu a je mnohem divoej a rychlej). Taky jim to dv uritou monosst dovat sse sskoro nessmrtelnch vk na Plni negativn energie,
chrnni ped moc Boh.

Mraziv dech: Argonantuss: J mysslel, e jssi ssi ten lnek peet. Tam pssali, e drak vydechuje obrovssk mnosstv kaplanho plynu na ob. Pssali tam dussk, J bych sse sspe pimlouval k methanu (kter tam pouvaj mssto acetylune, kter jssem navrhl na ohniv dech: ale acetylen je mnohem vhodnj). Mno a draci dok v njkm orgnu, ssnad i v plicch sstalit pohyby prssnho a ebernho ssvalsstva objem plic tak, e dochz ke zkapalovn plynu, kter sse pak vlasstnm tlakem pi ohvn vyhrne z jeho sst. Chtl jssem ssi tyhle vci propotat, ale vkend jssem sstrvil ss Drowmi bohy a anatomii Drow:-)
Tahle teorie ale dokazuje, e mohou pouvat ob dv techniky zrove, ale na sseveru, dky tomu, e jako inicitor plamene jssou enzymy v sslinch, kter sse ssamovznicuj u pi 44C, je metoda ohn ponkud nevhodn. Mon pokud by ssi to zapaloval ssirkama.
Dle to nevyluuje ani ohniv draky, protoe, jak kombinace acetylenu nebo methanu ss kysslkem v kapalnm sstavu, ohe nevyluuj, by dokonce holav rychlesse rozpnajc kapalina udl vt "nepodek" ne obyejn exploze plynu.
argonantus24.3.2003 (12:17)
Wothan:
no jo, ale pro je tak obrovsk a siln?? Pro se vn vech mtotvrc, ponaje eky nejmn, nesoustedily teba na sfingy, gryfony nebo mantikory (i kdy to tak nejsou dn salti?)
argonantus24.3.2003 (12:25)
darkelf:
s tebou je to sloitj. Jen krtce - pak musm obdvat:

ivho draka ovldnouti - o tom jsem skuten neslyel, souhlas. Ale co s mrtvolou? Ta u pece dnou vli nem...

Dra lichov nevypaaj nezajmav...

Ohniv a Mraziv dech: jo, peet. Jenome jsou to dv pln odlin vci. Mraziv dech se mi stle jet jev bt Tolkienovou inovac, vynalezenou jako protiklad draka ohnivho (i kdy u jsem se minule pln zbodl s tm drakodlakem - tam vymyslel Tolkien jen slovo, npad je pradvn...)
Technicky by drak skuten mohl mrazit duskem - i kdy tlako ndoby uvnit draka... vypad to dot sloit.

S ohnm jsem nael ke svmu vlastnmu pekvapen ten skvost v bitv u Lehnice; pak je tu tak alchymie; pak je tu ten Tristan; pak je tu eck ohe (stle jet do vci nezapojen); pak je tu ta Wothanova sra. Nejen, e by to snad pi troe snahy lo technicky, ale jsou pro to i matn doklady myytologick (i kdy se objevuj jaksi najednou, v urit dob).
Wothan24.3.2003 (12:36)
Argonaut: trochu off topic, ale asi to bude znt a kdyby ne aspo to pobav, je to staen nkde z netu:

...Je zapoteb smsit ervenou m, prek z bazilik, lidskou krev a ostr ocet. Do podzemnho kamennho domu umstme dva kohouty, a ti nakonec snesou vejce, kter vysed ropucha. Z vejce se narod dva kohoutci, kterm asem narostou dra ocasy. Kohoutky potom zabijeme a splme, popel se rozete na prach a pid se tetina krve ryavce, vysuen a dobe rozeten. Ve se sms se silnm octem. Potom se do roztoku vkldaj rozhaven pltky nejist erven mdi a nechaj se v nm tak dlouho, dokud....

Usekl jsem to schvln, v o co jde? :-) Pak to sem hodm cel.
Wothan24.3.2003 (12:37)
Darkelf: co ta tvoje fantasy-mythologie? Ptal jsem se je to dlko...
darkelf24.3.2003 (12:37)
Argonantus:
Jen ssem ti napssal nzor na ledov dech....nic vc nic m, j v tom nehledm hisstorii.

Jassn, e by mohli obivit kosstru, ale ta nen zdaleka tak nebezpen jako Dra mrtvola ss du a vnitn magii! A proto sse nekromanti povtinou ssna udlat nemrtv z tch, kter jet due neopusstila (na bojitch atd.) Protoe je pro n jednodu jm ct pkaz ne ovldat magi kad kloub jejich tla! Mrtvoly bez du jssou jakssi pomalej a bez nznaku njak obratnossti.
Pouze bohov a jejich kn mohou navracet dui. Tam je to pak jin pssnika. Ale Draci jssou proti tomu chrnni, nebo Bohov assi v, e by to nebylo moc zdrav!
darkelf24.3.2003 (12:53)
Wothan: Nco z Forgotten Realmss a nco moje Hlavka!
Wothan24.3.2003 (13:31)
Darkelf: to je njak hra?
darkelf24.3.2003 (13:36)
Wothan: Kdo hled, je pro nj mon cessta k nalezen!
Wothan24.3.2003 (13:47)
Tak zase tak moc mne to nezajm, ale vyhledat to samozejm mu. J jen e se v tom evidentn vyv, take to muselo dt dost prce ne? :-)
darkelf24.3.2003 (13:50)
To dalo!
argonantus24.3.2003 (14:22)
Wothan:

evidentn se mne pokou dostat... piznvm bez muen - tuhle vc konkrtn neznm, ale pipad mi to jako autor, obeznmen se zkladn alchymickou terminologi, kterou mot vcemn dovedn dohromady... a vbec by mne nepekvapilo, kdyby na toho cittu byla njak pln konina (nen to Pratchett?).
Ta erven m a ostr ocet by uly; lidsk krev je netypick (uv se krev s jinm oznaenm - nejlpe krev panny, nebo tak nco); prek z bazilik je podezelej; a ten kamenn dm taky nic moc... jinak je tam mlo barev.

Jinak - Forgotten realms jsou snad nejznmj RPG svt vbec (snad s vjimkou Tolkiena); je na to licence nkdy od sedmdestch let (nevm ), pat to ke he Dungeons and Dragons (o t jsi musel slyet i ty, i kdy s tm nesouhlas), a Darkelf t tah za fusekli.
argonantus24.3.2003 (14:25)
Darkelf:
jinak ty nekrohrtky pat sp k uprm...
Wothan24.3.2003 (14:38)
Argonaut: no nejsp snam, ale sp se tak nezvazn bavm. Co ti k spis: Schedula diversarum Artium od mnicha Teofila Rugera?
Wothan24.3.2003 (14:41)
Nael jsem to kdysi dvno na webu, ale protoe v tomhle oboru nejsem zrovna moc kovan (i chemie mi trestuhodn mlo k), ptm se. Pln znn toho je:

Pes vechnu mnohotvrnost a "zmatenost" vak nkter alchymick receptury nepostrdaj logiku. Podle jedn z nich je zapoteb smsit ervenou m, prek z bazilik, lidskou krev a ostr ocet. Do podzemnho kamennho domu umstme dva kohouty, a ti nakonec snesou vejce, kter vysed ropucha. Z vejce se narod dva kohoutci, kterm asem narostou dra ocasy. Kohoutky potom zabijeme a splme, popel se rozete na prach a pid se tetina krve ryavce, vysuen a dobe rozeten. Ve se sms se silnm octem. Potom se do roztoku vkldaj rozhaven pltky nejist erven mdi a nechaj se v nm tak dlouho, dokud m nepijme barvu i vhu panlskho zlata. To je autentick text spisu z konce destho stolet, kter sepsal jaksi mnich Teofil Ruger pod nzvem Schedula diversarum Artium. Popel z bazilik nen nic jinho ne oxid zinenat a elem novho procesu je vyrobit mosaz, tehdy nepli znmou. Znme i vznamy dalch kdovanch vraz. Orl perut znamenaj salmiak, tkajc, tedy "ltavou" ltku, zelenm hadem se pro jistotu rozum erven oxid elezit, a pokud si had por vlastn ocas, je to rtu. Thlav drak znamen prvotn praltku, ohniv drak znamen sru atd.
Wothan24.3.2003 (14:45)
Myslel jsem e pro tebe bude zajmav hlavn ta datace toho spisku, ale protoe u ani nevm odkud jsem to vythl (narazil jsem na to pi hledn historie vroby mosazi) nen to dn relevantn dkaz ani argument, sp zajmavost.
argonantus24.3.2003 (14:48)
Wothan:
"text spisu z konce destho stolet, kter sepsal jaksi mnich Teofil Ruger pod nzvem Schedula diversarum Artium" - !?!?
To fakt nkdo nael nco takovho z destho stolet??

Nebo ex post nkdo tvrdil, e to psal nkdo v destm stolet? J byl na potku hotov zavrhnout i toho Artfia - kdybych neml tolik podobnch doklad od poloviny 12. stolet, ponaje Krlovskm porlem v Chartres (co je tko ignorovateln obejt...), a kdyby nebylo toho Bacona...
Bohuel nejsem jazykov machr, take nevm, co znamen v ei ptk "Ruger" - ale obvm se, aby to jmno nebylo nco takovho, jako Abraham id, nebo Christian Rosenkreuz... u ten Teofil vypad trochu podezele... ale tady zase dlme nco, co pat na "hermetismus", i kdy oni se z toho njac draci brzy vylhnou...
argonantus24.3.2003 (14:58)
Wothan:
jeliko se to tu zjevuje v dost nesmyslnm asovm poad, tak odpovdm na tvoji pedchoz zprvu - jo, myslel jsem si to; spchal to njak renesann koumk, co to ex post oznail za star, aby oblbnul takov tpky, jako ty a j, co roztaj, kdy je to uleel...

Podle veho mho nejhlubho vdom a svdom v 10. stolet nem alchymie v Evrop co dlat (tedy nikoli tak v Arabskm svt; tam mli nskok, ale pak toho njak nechali).

Zptky k tmatu - jako jeden z prvnch pspvk na tomhle velefru vbec jsem uvdl zkladn typy uit draka jako alchymickho symbolu... take vcemn souhlasm. Chemie je pi ztotoovn symbolu s konkrtn ltkou asto sp na kodu (oni taky neznali jinou terminologii, ne tu svoji vlastn - prost pracovali se lvy a draky, ne s oxidy - to je, co, Darkelfe?)
Wothan24.3.2003 (15:00)
No a co o tomhle spisu tedy v konkrtn? Mn by zajmalo kdo to napsal a jestli to technicky jako vroba mosazi funguje? Ne e bych to zkouel, pece jen to asi nebude optimln postup, ale jsem prost zvdav.
argonantus24.3.2003 (15:11)
Wothan:
o tomhle spisu jsem v ivot neslyel, a za podezel ho mm (krom t podivn datace) proto, e toho velikna necituje nikdo z jeho koleg (je to toti jedna z nejjednoduch kontrol - alchymisti na sebe s oblibou odkazuj navzjem), tedy napklad ho nem Flamel ve 14. stolet, kter serotoval dost poctiv ve, co ml k dispozici.

Pevody symbol do jednotlivch prvk jsou zken vc, pravm; skoro kad alchymista uval symboliku vlastn; a kad s oblibou mtl zejmna tm, e stejnou vc nazval rzn (a dv rzn vci zase stejn); symbolick jazyk tohoto typu podle mne nejde rozlutit ani modernmi deifrovacmi metodami (...s nejednoznanmi vznamy je prost tk prce). Take - pokud si je neznm internetista jist tm pekladem symbol, tak to fungovat bude... a pokud ne, pak je to mimo... napklad thlav drak coby prvotn matrie mi njak nesed...
argonantus24.3.2003 (15:15)
Wothan:
jo, a abych nezapomnl - mosaz vtinou nen mosaz...
Fanda25.3.2003 (12:18)
Argonantus a dal ikmooko-zvdav: budete si na to muset njak ten ptek pokat - jsem rd, e si urvu as na to, abych tuhle konferenci etl a obas nco pidal...
darkelf26.3.2003 (13:42)
Wothan: ztra ssi to ssthnu a zkussm sse na tu vrobu mossazi pess vkend kouknout!
Wothan26.3.2003 (14:29)
Darkelf: dk, zajm mn jestli to je vbec mon.
argonantus27.3.2003 (0:45)
Wothan (a taky Darkelf):
Mon to asi je; vtip je ale v tom, e je mon nco jinho, ne ty od toho oekv.
Mosaz je toti tak Venu, v erven suknici, podkasan zelenou, jak upozoruje Basilus Valentin. Je to jen dal symbol.

Kdy u alchymie, tak symboly dra; zmnil jsi rtu (drak, kousajc se sm do ocasu). I tohle m hek; nen rtu jako rtu. Aby ada vychzela tam, kam m, mus se rtu liit od jin, kter by vedla k jinmu vsledku (Darkelf je profk, u tu).

pedvedu na pknm textku k drakovi v kruhu(by trochu pozdnm - jaksi pan Labsprinck, vydno 1678):
Straliv drak nanejv jedovat, jemu nic neunikne, pebv v lese.
Ten, spativ Slunce paprsky a zn ohe, ihned vypout svj jed
a poletuje tak pern, e dn z ivch tvor mu neodol,
ani sm baziliek se mu nevyrovn!
Kdo v, jak jej moude zahubit, ten ze vech nebezpeenstv vyvzne. Vechny drakovy ly a barvy se pi jeho smrti rozmno
a z jeho jedu povstane nejvy lk.
Jed svj velmi rychle strv, poraje vlastn jedov ocas;
toto ve je nucen provst sm sob.
Z nho pak vytk chvlyhodn balzm.
Popati peci na tyto sly a vichni moud se neobyejn nad nimi zaraduj.

Uijte si to!
S.U.P.27.3.2003 (9:01)
A darci nm pomalu umraj.
argonantus27.3.2003 (9:31)
S.U.P. (a taky Wothan)
Neblzni. Draci hned tak neumou - jsme stle na potku. Jen jsem musel na pr dn pry. Prv jsem se chtl ponoit do drak vcehlavch, ili san... kdy tu Wothan na jinm fru vythl franskou dra standartu - kde vzali Frankov draky? Od Viking? Od Kelt? To pro n nebyl drak zlo?
S.U.P.27.3.2003 (9:37)
Nemyslel jsem tim umrn drak jako tech doloench a rozebranch na tomto foru ale spi to e se toto frum njak odklonilo od draku..

Viz historie Frankov ..... netuim historie nen muj obor ja se radji vnuji tak njak pedstavm jak asi vypadaj draci co dlaj jak by se mohli domlouvat. Co jed rdi (teba temn elfy obry nebo radji princezny)?
argonantus27.3.2003 (9:49)
S.U.P.
Tohle monstrzn frum se - stejn jako jin monstra (elfov, Bh) u mnohokrt povliv vyklonilo ze sv trajektorie, ale nikdy to nebylo pln ke kod; napklad ta mongolsk odboka vedla k senzanmu nlezu skutenho ohnstrjnho draka (viz dole), alchymie tak nemus bt pln marn.

Ale abych uspokojil tvj hlad po dram hladu:
Drak pociuje - podobn jako lovk - hlad dvojho druhu. Ten prvn, jaksi technick, je dn tm, e drak mus nco rt, a je dravec. Nic objevnho na tom nen. O mnou pedpokldanm pravkm pedchdci draka se mysl, e lovil tvory stedn velikost v bainch, kter pepadal podobn, jako drav ptk; o Mareem pedpokldanm souasnm draku plat, e ere hlavn opice a jinou stromovou hav (co je dost sloit a zajmav lov, neb opice nen blb); zdrcujc vtina drak mtickch a stedovkch nepohrdla njakou tou ovc i dobytetem. Jak km, nic pekvapivho.

Pro literty byl ale vdy vce zajmav ten druh hlad, jaksi duchovn - draci pr miluj poezii, hdanky, zhady, magii, krsno (zosobnn diamanty i slenami). Zalistuje-li trochu dol, shled, e ad pravch stedovkch historek drak sleny nepor, nbr se s nimi chce oenit (a mon i fyzicky milovat) - odtud nkolikrt een problm drakodlaka, kterm jsme vlastn zaali, a kter se vrtil na scnu nkdy minul tden.
argonantus27.3.2003 (10:55)
Take - jak mte pomr k vcehlavm drakm (sanm?)
S.U.P.27.3.2003 (10:56)
Take sa je vlastn samice od draka.

No a pokud m takov sa vce hlav tak me uspokojovat i vce drak.
Wothan27.3.2003 (10:58)
J mm radi draky jednohlav, hydra nen mj oblben mazlek. Zato si vdycky vybavm vtu z jednoho legendrnho dlka "A co j?! ekla tet hlava a zaaly se prt" - odkudpak to je? Kdo to v?
argonantus27.3.2003 (10:59)
S.U.P.
Sp ne. Sa je pvodn heraldick termn pro vcehlavho draka. Pokud vm, vtina fantasy se shoduje, e sa - coby vcehlav drak - je prost jin zve. Nicmn spousta pohdek pouv vraz drak i v takovm ppad...

sexuln uspokojen vce drak tko, ledae by lo o orln sex...
argonantus27.3.2003 (11:00)
Wothan:
karel apek, Devatero pohdek. Ne?
Jinak j mm jet radi - ze stejnho zdroje:
"... a bude po ptkch," dodala sedm hlava.
Wothan27.3.2003 (11:01)
Tam taky, ale tohle je z Kemlka a Vochomrky! :-)
S.U.P.27.3.2003 (11:01)
a pak jedli lvance nebo je to jin pohdka?
S.U.P.27.3.2003 (11:03)
no abude dal oslava 400.....hodn tst zdrav....
darkelf27.3.2003 (11:14)
Argonantus: vcehlavosst dra penechvm hydrm.
Pro m je ssa jin druh draka (bez kdel)!
argonantus27.3.2003 (11:16)
Wothan:
jo vid, na ty jsem pln zapomnl. Tam je to taky. "BYL TO DRA OCSEK, VY CHYTRCI!"

Jinak souhlasm i s tm, e san njak souvis s hydrou... a se draky se mon skuten zmotaly sp dodaten.

S.U.P.
m njakho zvl᚝ oblbenho draka? K tm narozeninm, napklad?
Fanda27.3.2003 (11:29)
Lov opic: opice se lovit daj - ostatn po svt jsou na to specializovan 2 dravci - orel opi (tum e z Asie) a harpye (Jin Amerika) - zajmav je, e oba vypadaj podobn - maj takov dlouh pera na hlav - snad proto, aby se opice lekla. Draka by se asi lekala tak jako tak...

Vcehlav draci: je zajmav, e jsou znm i v Japonsku (ostatn je to zmiovno i v t dra Pevnosti) - jak se dostali do tamnch konin, mi je celkem zhadou - ta povst byla o jakmsi vcehlavm drakovi, kter njak kodil, ne mlad samurai umstil sudy s msi tak, e drak musel kadou hlavu prostrit jednm oknem, aby se k obsahu sud dostal. Schovan samurai mu pak hlavy usekal. Tato povst je zajmav i tm, e zde ten drak je zde evidentn onen archetyp I (bestie), zatmco mi pijde, e na Dlnm Vchod byl mnohem astj archetyp II (mudrc, uitel) - pokud si tedy to dlen na archetypy jet dobe pamatuji.
nojon Debe27.3.2003 (11:32)
Argonantus promine.
Wothan: pipomnm se na ta dla, runice a rakety.
darkelf27.3.2003 (11:35)
400
argonantus27.3.2003 (11:36)
Fanda:

Lov opic: nevm, zda je nhoda, e uvauje pln stejn, jako ten Mare v souvislosti s kongamatem... ten tak vzpomnl na orla opiho, orla harpyji a jet nco podobnho africkho...

Vcehlav draci:
tv historka je moc zajmav, a njak mi pipomn nco evropskho... je mon, e to je pevzat pohdka (z Japonska? i to by bylo mon...)

Lovm svoje pracovn rozlenn archetyp - I je ta hnusn bestie, kterou je teba zabt; II je bestie lchymick; tedy jen zstupn obraz za nco pln jinho...
drak coby mudrc bude asi muset dostat samostatn slo - IV. Prochzm vechny sv minul vlovy, ale evropskho draka - mudrce kupodivu nenachzm... nejvc se tomu podob moudr Jilocasin, ijc dajn za Karla Velikho, ale ten se oenil... a sklouzl nm do archetypu III, protoe o to tam jde pedevm...
argonantus27.3.2003 (11:38)
Wothan:
a j se pipomnm s franskou standartou (o nco dve zde).
darkelf27.3.2003 (11:39)
Nojon: Ne erm....
argonantus27.3.2003 (11:46)
... a mon by nemla zapadnout Darkelfova poznmka k vcehlavm sanm -NELTAJ. Opravdu mi to tak pipad. A respektuje to i modern DrD. Zmatek v tom dlaj jen pohdky, a to jet dost novodob (ten hnusn Troka).
Wothan27.3.2003 (11:50)
Argonaut: myslm e i v ruskch Bylinch jsou vcehlav ltajc san.
darkelf27.3.2003 (11:56)
Wothan: jssou, ale v Russkch bjch m sspe pipomnaj ptky ne plazy (ssice bez pe, ale ta pta hlava sse zobkem)
argonantus27.3.2003 (11:57)
Wothan:
reaguji na Wothanv skoro poledn projev na elfech - nikoli proto, e bych byl fanda drak, ale proto, e si myslm, e to systmov pat vc sem, protoe tady jsme to u jednou zaali eit.

Neelnost ve fantasy mi vad taky. Nen problm v tom, e nadbyten hroty na vlen sekye by vyluovalo njak pravidlo - vdy fantazie by nemla mt hranice - ale to, e ty hroty jsou nekonzistentn, neeln, nesmysln - a tud vlasn ne hezk. Ten lovk neml fantasie pli mnoho, ale sp byl lajdk, e to byl ln domyslet.
Slavn je ppad Leonardova andla - ten obraz fancinuje mnoho lid tm, e ten andl nem dla "tak njak nalepen", ale vychz ze studie ptk, a dl dojem, e narozdl od zdrcujc vtiny andl by mohl fakt ltat... take je tm zajmav a krsn. O to mi mimochodem lo na potku rozboru drak zde (nen to tak moc off topic, S.U.P.e - naopak, jde to ke koenu vci).
Vad mi ale tak druh konec hole, kter Wothan nezmnil - fantasy je ve skutenosti fantasie, kde se nesm skoro nic. Mus se tam eit jenom rzn zpsoby zabjen; magie je omezena jen na stanoven schmata; bda, kdy se njak hrdina zamiluje, a hrdinka neskon rozsekna na hadry; a je to krlovna nebo uprka, mus se j prsa drt z vstihu... atd.
Historie je proto pro peit fantasy ivotn nutn. Stejn jako skuten svt prakick zkuenosti, vlastn pokusy a zludn otzky, kter jet nikdy nikdo nepoloil...
Wothan27.3.2003 (13:24)
Darkelf: nebude to sp tmi ilustracemi? :-) Taky je mm od dtst vyplen do mozku :-))
argonantus27.3.2003 (13:27)
Wothan i Darkelf:
nejsou nhodou rut draci (nebo jsou to san?) potomci eckch mt o hyde? Tedy - nen vcehlavost drak naopak vchodnj evropsk specialita (ta Fandova nov historka by tomu odpovdala...)
Wothan27.3.2003 (13:33)
Argonaut: mon to je - ist kulturn me bt spousta vc v Rusku kombinac eck (Byzanc) kultury a tradice Asijsk (Mongolov-hordy) take ani v ppad mt a tedy i drak to nen vylouen.
argonantus27.3.2003 (13:38)
Wothan:
take potom my, echov, jak znmo na hranici mezi obma svty, si meme spokojenuvat obou drah varant, kter se nm v pohdkch ms v divokm zmatku (a v posledn dob s pevahou Zpadu vedou ve fantasy jednohlav draci...)

nicmn jet jednou t prosm o skok k t fransk dra standart - pln mi uniklo, e by Frankov takov znamen uvali... to mli od Viking?
Wothan27.3.2003 (14:12)
Argonaut: to asi tko - Frankov byli na vym stupni vvoje, nemli potebu se uit od Viking ani od nich vtinou nic pebrat, vypad to na domc tradici. Ta standarta je mon sp had ne drak - m to dra hlavu, ale vlajc tlo. Pravdpodobn je ta hlava plastika, protoe je upevnna na tyi a vlajc tlo je textilie. Napad mne velmi odvn mylenka e by mohl jt o msk relikt - nkter pomocn sbory pouvaly jako signum draka na erdi - draconis. V tomhle ppad by to nebyl nhodn odkaz - fransk vojenstv a to jak merovejsk tak karllovsk t z pozdn Antick tradice i v jinch smrech a tady je zjevn usazen plastickho prvku pmo na er - korouhve a praporce maj jinou konstrukci. Jinak ty draky najde teba ve Zlatm alti, bibli Karla Holho a dalch franskch iluminacch.
darkelf27.3.2003 (14:18)
Wothan: V, e m vlasstn pravdu?
argonantus27.3.2003 (15:12)
Wothan:
vid, to je dal vtev dractv, kter mi pln unikla. Tak njak jsem pedpokldal, e romnsk (a i o trochu star, karolinsk napklad) umn vzalo sv draky od kelt (kodex z Lindisfarne a jin vtvory). Vbec mne nenapadlo, e i mani mohli mt draky... kteto by je zase mli asi od ek (viz ve - jsou tam tutov draci modelu I. i II.).

Drakologick mytologie se nm tm ovem spe zamotv. U mne napadla pochyba, zda et draci vbec ltaj, a zda to nejsou vlastn hadi (pokud si d prci a vleze k mmu mytologickmu vlovu, jedin slavn antick drak nutn ltat nemusel); odtud by nemuseli ltat draci man, a potamo ani Frank.

Ovem tm divnj je, jak pili ekov k ltajcm sanm (a nebo to zase a ti Rusov, kte si vypjili od ek mnohohlavost hydry, a od sevean ltn...?)

Prolezlost evropsk mytologie draky je prost k neuven; je jich tam jet mnohem vc, ne jsem si pvodn myslel.

S.U.P.
dlu nm oblbenho draka. My s Wothanem jsme se vlastn u vyznali (Glaurung a Ffnir; co je asi v zsad to sam).
Wothan27.3.2003 (16:12)
Argonaut: vezmi si jak daleko sahala msk e a kde tedy byly romnsk oblasti a sfra vlivu. Jak v Britnii tak v Galii m jak keltsk tak msk vliv - tady se sotva doptr njakho zvru. A mimochodem stejn zstavy - tj. drak na tyi jako u Frank bys nael nap. v Britnii - viz. standarta Wesexu jet u Hastingu...
elder27.3.2003 (16:43)
Hur, hur! Konene som si toto montrum dotal do konca. Trvalo mi to s prestvkami na tak banlne veci ako plnenie pracovnch povinnost a zkladnch fyziologickch potrieb len jeden a pol da :-). Z vs, chlapi, musia ma vai zamestnvatelia rados, o :-). akm kedy zane na ma zazera moja fka (alebo u vs je to in?). Ete si tak preta frum Boh a alie, ktor sa uteene rozrstly. Hm, ignorova diskusiu na Pevnosti kvli prci a potom sa hodi na tde na PN-ku sa moc nevyplca :-). No, ale k tme.

Mte, slovutn drakolgovia, povedomie o isto slovanskch (staroslovanskch, praslovanskch) pomenovaniach pre drakov? Dotali ste sa niekde, alebo mte npad, ako by mohli nai predkovia nazva takto tvory, bez toho aby si vypomohli latininou resp. grtinou? Akceptujem aj vlastn vtvory znejce dostatone slovansky. Mne sa, okrem takch vednch nzvov ako plaz, jater, had i erv, nepodarilo njs ani vymyslie ni poriadne (upozorujem e na slovensku asto pouvan "arkan" m tureck zklad). Vopred dk za info.
Argonantus27.3.2003 (18:03)
Elder:
vborn otzka. U ns v "Bohemii" je to jednoduch - nejstar psemn zprva je zejm ten kanovnk Vyehradsk (1130), v originle latinsky, a celoevropsk vraz "draco" zejm pevzala etina dost zhy (pesn doklad chyb, ale u povst o Bruncvkovi, dov 14. stolet, s tm nem problm.)

Kdy byly sepsny byliny, to se zeptej Wothana, nebo toho manka, co pipojil koment k jednomu ze t drakologickch lnk na hlavn strnce. Obvm se, e dost pozd.
Mimochodem, nen tm hledanm slovanskm vrazem prv "sa"? Tum, e to dl na zpad nemaj...
Slovo arkan jsem zapomnl, ale je dost rozen - pinejmenm Polci mu rozum (ei moc ne). I to znamen, e Turci to pojmenovali jinak, co je velice zajmav (svd to o oddlenost tureck ideje draka...)
Fanda27.3.2003 (19:35)
Argonante, te si trochu uhodil hebek na hlaviku - je-li sa vcehlav drak, jak se mu sakra k na zpad od ns, N.B., kdy je to erbovn zve.

Shakespearovsk "Zkrocen zl eny" - v originle tum "Taming of the Shrew" by mlo bt "Zkrocen san", nebo mon draice. Kadopdn bychom tu mli dal slovo pro draka, kdyby tedy "shrew" nezmenalo i rejsek - otzka je, nakolik to vad.

A ti Slovant draci? - Osobn jsem v tomto ohledu dosti skeptick (sakra, a v jakm ne??) - rusk byliny se daj nakrsn naknout z Vikingskho vlivu a obvm se, e o staroslovansk mytologii se toho v pramlo (a to co se vdlo, tak s tm zamchala jet rzn nrodn obrozen). Nicmn ponechvm prostor povolanjm.
Jak vlastn kaj Rusov drakm?
Cel tohle m m ale na otzku Ptka Noha - co ten - je to tak velk ltajc potvora a njak nevm, k jakm pronrodm ho piadit.

Jet si dovolm reagovat o tom vlivu "vcehlavosti" na tu Japonskou povst - je otzka, z jakho je stolet, ale obvm se, e na evropsk vliv se to bude svdt tko a o vlivu kesanstv, kter tam zaalo pronikat a nkdy v 16. stolet by lo s spchem polemizovat, nevc, kdy ani te nen kesanstv v japonsku nejrozenj. Mohli by to samozejm pijmout od an, od kterch ve stedovku pejmali kde co, ale njak mi to na ty any nesed. Me to bt i originln japonsk vmsl, ale kamiel o jejich mytologii toho tak mnoho nevm.
elder28.3.2003 (7:02)
Argonantus: S tou saou (san), m mono pravdu, aj ke na Slovensku som sa s pouvanm tohto nzvu skoro vbec nestretol. Dokonca, si pamtm, e ke som ho prvkrt niekde tal, nemal som vbec potuchy o om je re (skr som si to spjal s tm sofistikovanm vynlezom na spanie sa po zaseench svahoch :-)). Nie je to, nhodou, isto esk pomenovanie? Ale skr asi nie, o?
Spomenul som si e poliaci maj na draka aj slovo "smok" (tolkienisti, nepripomna vm to nieo? :-)). Aplikovanm na sloveninu alebo etinu mi ale vychdza nieo ako zmok (zmek), o m vak, poda ma, bliie k pomenovaniu nejakho "niolevelovho" tvora z pekelnej eliadky (nieo ako imp).

Fanda: Nemm vea znalost o ruskch bylinch, ale mm pocit, e tam by sme sa tie najskr stretli s nejakou odvodeninou od "draco". Vplyv Byzancie na naich vekch bratov bol predsa len dos znan. Ete sa mi mar nieo o arkanovi v nejakej ruskej rozprvke, ale to je mono len prekladatesk let, aj ke, na druhej strane, Osmansk ra mala s matikou Rusou tie nejak pletky (ostane, s km vo vchodnej, junej a strednej Eurpe nie, vake).
Noh sa mi nejak spja s junou ziou (India?) ale u neviem preo. Niekde som to tum tal. Ale urite m niekto presnejie informcie.
elder28.3.2003 (8:37)
Tak ma napad, z akho jazyka vlastne slovo drak pochdza? Je to grtina alebo je to nieo starie? Nem nhodou pvod v spolonom indoeurpskom zkladnom jazyku? A o to vlastne v preklade me znamena? Vie to niekto? Ako sa po nsky povie drak? o to znamen? Myslm e, ak sa podar toto rozlti dostaneme sa v ptran po prvotnom pvode a prpadnej relnosti drakov bliie.
argonantus28.3.2003 (9:12)
Fanda - jako obvykle velmi inspirujc:

1) Sa na Zpad - sue pedpokldm, e nen-li na Zpad mtu san, nen teba slova. ach!
S heraldickmi doklady - nejsem takov machr na ciz heraldiku, abych si byl jist; ale v ivot jsem neslyel o erbovn sani star renesance (a v renesanci je mon naprosto vechno; zde dovol zmnku o zejm lenm heroldovi Vladislava Jagellonskho, kter vyrbl vci jako "medvdojelen v barv pirozen"). Bylo by moc dobe, kdyby se nm tu nkdy stavil Divous - teba v vc.

2) "Shrew" - opt problm - nejsem takov znalec jazyka. Slovo asi bude hodn star (Shrewsbury, tolik milovan tvrkyn bratra Cadfaela) - ale netum, pro by mlo nutn znamenat vcehlavho draka, ppadn mt vbec cokoli spolenho s draic, jak pedpokldme my (rejsek v penesenm smyslu - zl ensk?)

3) Osobn jsem byl zpotku otzkou slovanskch drak zaskoen - piznm se, e byliny se mi pln vykouily z hlavy (narozdl od Wothana, Darkelfa a toho manka z hlavn strnky, co tu tolik absentuje). Ale opt, jako ji nkolikrt, kapituluji ped fakty (o spoust vc, o kterch tu mluvme, jsem na potku tto debaty neml ani tuen!)
Slovant mnohohlav a ltav draci prost jsou; velmi zhadn je jejich st; a velmi zhadn je jejich pvod - a dky Elderovi je konen problm i jejich oznaen (tvoje otzka, jak vlastn kaj Rusov drakm, trv - j nevm). Vimni si, jak jsme spontnn vychrlili nkolik zcela novodobch hit - Kemlek, Bajaja, Devatero pohdek, Z pekla tst - a ve vech se sue pedpokld dra mnohohlavost a ltavost...

4) Vikingsk vliv v tto vci spe odmtm; Wothan sprvn upozoruje, e velmi sta draci Viking (asi 9. stolet, ne-li dve) se hodn podobaj drakm Frank a do jist mry i Kelt a man. Rozhodn nemaj vce hlav!

5) Ptk Noh - tak te jsi to vyvedl. To je na dalch 100 pspvk. Osobn si myslm, e ptk Noh je prost jasn doklad m tze - nkte pravc ob ptrosi, ijc nkde v Indickm ocenu, vymeli nkdy v renesanci; prv, kdy tam dorazili prvn badatel. Tohle je fakt; pokud chce, dohledm podrobnosti. Prv proto pedpokldm paraleln dj s drakem, jak o tom byla e na potku fra, kter se ovem musel udt o dost dve (v renesanci u iv draky moc nepedpokldm...)

6) Japonsko - nikoli, myslel jsem to pesn obrcen: vcehlav drak me bt klidn mylenka Japonsk, kter se k nm dostala do Evropy (logicky do Ruska nejdve - a tady jsou nasnad zase ti Mongolov; moje poznmka o tom zcela zapadla... byli v Rusku dost dlouho na to, aby si tu mohli povdat pohdky, kter Rusy zaujali... a pak by byl dvod i pro odlin slovo (ten zatracen arkan, nebo sa). Ono toti, podle mne, vcehlav potvora jasn v Evrop ped vpdem Mongol doloena nen (viz tvoje sprvn pohrdliv poznmka o slovanskm psemnictv - me to bt dost nov)

7) Co je kamiel?
argonantus28.3.2003 (9:22)
Elder:
Vdy je skvl, kdy pijde nkdo nov - zjevn to obohat pohled. Donedvna jsme vichni automaticky pedpokldali, e slovo "drak" je universln minimln v Evrop (nco takovho je patrno z vcero starch glos, i mch). Jist je ten slovn zklad prakticky ve vech jazycch germn a romn; krom toho v etin (ktrer to jist pejala - ale fascinujc je, znovu pipomnm, e v roce 1130 kanovnk popisuje neznm jev odkazem na draka jako na znmou skutenost...), etin; keltsky neumm; zajmav by byli asi pobaltsk zem... vbec - nejpestej terminologie je zjevn prv na vchod (te u i smok - pravda, jak nevzpomenout "moky pravdpodobnosti pana Lema!)

Tvj dohad, e by to mohlo bt indoevropsk slovo, se kterm prvn evropan na scnu u pili, je nasnad - ale tm to nen mn fascinujc (pak by toti museli bt draci i v Indii - tam taky nevm... a pipomnm, e Indov jsou velmisti v mnohohlavosti...)

K Nohovi viz mj dnen vzkaz Fandovi (a potamo se to vztahuje na Rucha adal pdobn vci).
argonantus28.3.2003 (9:27)
Elder:

jo a jet - k celkovmu st drak pipomnm shodlouh 21.3. v 10.09, bod druh - ve svtle tto skutenosti je teba se na to st dvat; je to jeden z nejstarch mt vbec.
Mimochodem - existuj draci minimln z Babylonu, ne-li sumert...
Wothan28.3.2003 (11:23)
Ad Byliny - pesnou dataci neznm, ale to bude pot s tm e i tady fungovala stalet stn tadice a zpis je a velmi pozdn. Jinak vliv germnsk - Vikingsk (pesnji vdsk) tu bezesporu byl tak, ale ani to nee vcehlav san - odtud obvm se vtr nevane.
elder28.3.2003 (13:52)
Trochu som sa poohliadol po tej etymolgii slova drak na nete. Naiel som toto:

---
English-Chinese Online Dictionary http://www.tigernt.com/cgi-bin/cedict.cgi

[chi1] /hornless dragon/
[huo3 long2] /fiery dragon/
[jiao1] /scaly dragon/
[long2] /dragon/imperial/Long (a surname)/
[qiu2] /young dragon with horns/
---

Celkom dos vrazov, o? o znamenaj tie sla na konci slov vbec netum (vslvnos?). Myslm, e pre draka najasejie bude slovo "Long". Ale o z neho vyta? Nepoflakuje sa tu niekde nejak nsky jazykovedec? :-)

Cez ten ist slovnk som sa paradoxne dostal aj k tomuto:

---
dragon
Etymology: Middle English, from Old French, from Latin dracon-, draco serpent, dragon, from Greek drakOn serpent; akin to Old English torht bright, Greek derkesthai to see, look at... tu u ni alie nebolo
---

Vyzer to, e sme sa dostali akurt k tomu serpentovi - plazovi. Ete sksim vykuta nieo z toho "derkesthai". Aj to staroanglick "torth" - bright (jasn, svetl, iariaci ale aj vtipn, ikovn, vynaliezav) vyzer zujmavo.

V mne dostupnch keltskch a galskch slovnkoch som, bohuia, slovo drak nenaiel. Akurt "dragonfly" = "tarbh-nathrach", kde "nathrach (nathair)" m preklad "serpent, snake, adder". Hm, slep ulika? Ptram alej :-).
argonantus28.3.2003 (14:03)
Elder:
no vid - nco tak evidentnho, jako hledat ve slovncch, ns zrovna nenapadlo.
O zmnch drak a had byla e na potku, a thne se to celm drakologickm problmem (a nikdo se jist nediv).

Ale tak mi pipadne, e takov ssa, ssmok, ssnake, sserpenss a snad i ssarkan maj nco sspolenho - jsou takov plaz...

kdeto drake, draco, draak, drakan, drak, derkesthai jsou takov tvrd, a krystalovit...

potud k pln a konen rehabilitaci Darkelfovy drow mluvy... v ve zdnlivch pkovinch lze najt neekan pekvapen
Fanda28.3.2003 (14:04)
Tak mm radost, e se to tu st na debatu ohledn vraz, na kterou jsem poukazoval u nkdy na zatku tohoto fra ^_^

Pokud jde toho ptka Noha, tak pochopiteln tu je ptros a dle tu il njak takov ptrosoid na Madagaskaru (jak se to on sakra...) a vyhynul tam celkem nedvno - faktem je, e byl ale Madagaskar osdlen relativn nedvno (kdy netum) a to nikoli z Afriky, ale od Indie, no a pak rzn emuov, nanduov, kasurov a (tak u vyhynul) moa. Bylo-li nco takovho v Indii, nevm. Kadopdn nic z toho nelt - take i tohoto tvora vznesla do nebes a lidsk fantasie, stejn jako tu perostlou jetrku, o kter je tohle frum.

Argonante, s tm rejskem me mt pirozen pravdu - tady by to chtlo opravdu njakho "anglologa" - nadhodil jsem to jen jako monost.

Kamiel - to je takov moje japonsko-esk slovn hka - "kami" je japonsk vraz oznaujc v podstat boskou bytost (no dobr, taky vlasy, papr a mon jet nco jinho) - take "bohuel" vztaen na Japonsko ^_^

Nicmn ta Eldarova poznmka m pimla spustit Japonsk slovnk a tohle z nj vylezlo po zadn vrazu "dragon" - psno v estk traskripci:

DORAGON - evidentn pevzat z anglitiny a pro ns tety nezajmav
GARJ / GARJ - lec drak (ve druhm vznamu "velkolep mu" - osoba skryt za masami)
HIRJ - letc drak
KRJ - drak, kter vystoupil na nebesa
KRJ / KRJ - deov drak (ostatn tato pedstava nen ojedinl - akoli se jinde, tum u Indin, jednalo o okdlenho hada, ale opt me jt jen o rozdlnost pojmenovn) - jinak to sam v druh vznmu coby "skryt gnius"
RJ - tak toto je samostatn vraz pro draka, tak jak je - je to ostatn vidt na sloeninch ve a ne (2. vraz je uveden jako "promoted rook" - ale netum, jak to rozum peloit)
RJDIN - dra bh, dra krl
RJ - Dra krl (mon t jako krl Drak)
TACU - drak, jakoto znamen z nskho zvrokruhu, takt onen paprov nsk drak - je pravdpodobn, e se bude jednat o japonsk ten nskch znak
WAIVUXN - tak tohle mi nazn japonsky ani trochu - v anglitin jako wivern (dvounoh drak)

Doufm, e jste se vzdlali. Kadopdn mi z toho vyvstalo dal slovko - "wivern" - tohle se tak tu a tam pouije - take to je co a odkud?
argonantus28.3.2003 (14:38)
Fanda:
Kruhem jsme se mnohokrt vrtili k vcem, kter jsme vzali neprvem moc rychle...

1) Noh jet - no, to ltn bych vysvtlil prv tm nedorozumnm, jak jsem popisoval u velryby a draka na potku. Kdy nkdo zaslechl o "pern velkm ptkovi", pak prost pedpokldal, e ptk lt (to d zdrav rozum - alespo uenci, kter ptrosa a podobn vci v ivot nevidl). Okdud a kam se pohybovali zprvy o tchto ppadech - to u po mn nechtj; pro nae evropsk ely se to obvykle schov pod bezedn pojem "arabt kupci", kte to docela mon mli od nkoho dalho. Apropo - kdo vidl vycpanho Moa v Nrodnm muzeu, uzn, e je skuten pern velk...

2) Kamiel - nebyl jsem si jist, ale tuen se naplnilo v pln hrze (na jinm fru jsem zahldl "Thoruel" (to jen pro Wothana ke konstrukcm vry).

3) Maj-li Japonci svoje "rj", jet s mnoha praktickmi sloeninami, a ani "long" a kdovco jet (pro se long podob anglickmu "dlouh"? nhoda?), pak to jen potvrzuje jakousi asnou a pornou mytologickou potebu draka, kter jest asi hlavnm tmatem a pinou tohoto fra...

4) ist pro tv pobaven - odkaz http://www.novinky.cz/Index/Styl/697.html
(pokud mi ho nkdo zas nesmae), pro milovnky kryptozoologie... a mimochodem, d se najt odkaz i na to kongamato
argonantus28.3.2003 (14:41)
Fanda:

jo, zapomnm - vivern, nebo taky wyvern - hrm Might and magic zase notoricky znm vc;
hnusn jedovat drakoidn mrchy, jacsi "ni" draci, kte by sice mohli bt odplkovni mezi novodob fantasy vtvory, kdyby tak siln neevokovali ty "jedovat" a "magick" souvislosti s bazilikem (a zde nemohu, ne odkzat na Darkelfv excelentn popis bazilika v Alchymii)
Fanda28.3.2003 (15:46)
Argonantus: Pro v pln hrze? Jazyk je iv vc, tak pro si s nm nkdy nepohrt jen tak - pro zbavu, zvt, kdy nm to nae matetina dovoluje.

Jinak jsme zase u toho jako na zatku: vude se nm vyskytuje njak velk jetrka, kter se k rzn a i pohled na ni je rzn, protoe to, e njak Gaidin pojmenoval Rj jako draka mohlo bt jen pro dostatek jinch vraz. Ale ta poteba velkch jetrek je nepopirateln. A je dobe, e tu je ("... a sili sm dra, my to prvo mli...").

Ad ten odkaz: Pkn, le pesvdiv pm dkaz chyb. koda, taky bych rd, aby se nm tu prohnl sem-tam njak ten dinosaurus, nebo ptakojetr.
Divous28.3.2003 (16:05)
K tomu nohovi - ptk noh alias grif mohl bt klidn velkm ptrosem, pro ne, jen m pak ale mate, e mytologick grif (kter figuruje i v heraldice) m 4 konetiny......
Horn jsou orl a doln lv, pak je to gryf a nebo je doln plka z kon a pak je to hyppogryf.
No nic, tak popemlejte :-)
Fanda28.3.2003 (16:25)
Divous: takhle ten gryf odpovd +- tomu, co mli Babylan...

Jo, pro to tu pi - Argonante, ta podobnost nskho "long" s anglickm bude na 99% nhodn - nedivil bych se, kdyby tohle slovo mlo v ntin jet alespo 10 vznam v zvislosti na tom, kam d pzvuk a co jak prothne a rzn regiony ny do toho radi ani nemchm.
Argonantus28.3.2003 (17:48)
Divous:
fajn, es zavtal. Kdy m nejstar trojhlavou dra potvoru (spe ciz, ne nai - u ns je to bda...)?
Gryf - dal zhada; tady je ale ta mont dvou potvor zjevnj (nejmopcnj v heraldice je orlice a lev, pro je nespojit...?).

Vichni:
Pedevm jsem zase u svch domcch zdroj informac.

1) Take, abych pokraoval v off topic Nohovi, kter opt nen pro draky pln nezajmav:
- Aepyornis maximus - velikost 3 metry, Madagaskar, pbuzn kasura (le bez hebene a velice vysok, vzhledem ptrosovit) vymel zejm ped 200 roky (!), tedy jet pozdji, ne jsem myslel.
- Dinornis giganteus, ili novozlandsky "moa" - velikost 3,60 metru, Nov Zland, pbuzn ptrosa a nikoli Aepyornise, opt vymel asi ped 200 roky - nejasn zprvy jet z potku 19. stolet. V obou ppadech jim dalo smrtelnou rnu zemdlstv.
- Emeus crassus, men a obznj moa, 1,80 metru, t Nov Zland, pedpokld se vymen ve 13. a 14. stolet (a ivho ho tedy dn badatel nevidl).
- Euryapterix elephantopus - opt moa z Novho Zlandu, jen 2,20 metru vysok, ale dsn tlust a mohutn, vymel asi ve 12. stolet

2) Mnohohlav draci:
moje mysl pracuje pomalu a skleroticky- reaguje asto na vci, kter nkdo ekl pedminule (v tomto ppad Wothan o trojhlavm alchymickm drakovi a Darkelf o ptach hlavch). Teprve dnes mi dolo, e tohle samozejm znm - Splendor Solis od Salomona Trismosina, jeden z nejslavnjch a mon nejndhernj alchymick spis vbec, kter mm doma hned ve tech verzch (rytiny, ernobl foto a reprodukovan barevn pohlednice). Pohchu v textu nejde penst, na co se prv dvm - srdce milovnka drak by zaplesalo.
Dlko vylo 1582 v nkolika verzch; ta nejproslulej je pekrsn rukopis, chovan v Berln, s 22 obrazy. Ns zajmaj zejmna obrazy 14 a 15; na tom prvnm je ve filosofickm vejci trojhlav bl ptk, pipomnajc labut i husu (to jsou ty pta hlavy - klidn to mete vydvat za draka z Devatera pohdek), na tom druhm pak ji nepochybn trojhlav drak, s hlavou ervenou, ernou a blou; pi tom oba tihle tvorov maj zjevn kdla.
Salomon Trismosin je zhadn a bda; pedpokld se ale, e byl ze Saska; me bt o dost star, ne uveden datum (skoro o sto let); a z rznch dvod si myslm, e psobil i v Praze. Nyn rozhodnte, zda mohl mt vliv na Vchod i Zpad - j myslm, e ty obrazy mohly uvznout v hlav lecjakmu mali, a to i v jin souvislosti (ilustrace Bylin...)

3) Draci Babylonu - jo, m recht, Fando, vypadaj dost divn, a jsou tak njak smontovan... sp maj nco spolenho s tm gryfem.
Divous28.3.2003 (18:43)
Co se vcehlavch drak te, tak ten zdroj inspirace bude star. eck mytologie zn vcehlav draky-san, nap takov Hydra.
Ale nepodceujme jin zdroj inspirace z roku 99 naeho letopotu - Apokalypsa svatho Jana. Tam m v jedn kapitole vidn vcehlavho draka-monstra tak
argonantus29.3.2003 (10:50)
Divous: Touch!
nikoli s tou hydrou - o t jsme u mluvili, a je to hodn divn potvora, kter se moc v inspiraci neprojevila... ale se Zjevenm svatho Jana, na kter jsem pln zapomnl (zase!) - samozejm, tohoto vcehlavho draka museli znt po vem kestanstvu....

Vichni:
Dvm se na problm dkladnji, a provdm vlov Apokalyptick...
1) Celkem je shoda v vdy, e to Jan vyrobil nkdy okolo roku 100 naeho letopotu (pesnji nen moc jisto).
2) Drak se objevuje na scn v kapitole 12 Zjeven, pokrauje ve 13, a objev se i v 19. Mm k dispozici ekumenick peklad z r. 1983, kralick peklad, a Melantrichovu bibli z r. 1570, kter je pedkralickm pekladem z latiny - jeto se podivnosti textu projevuj shodn ve vech, pouiju Melantricha, kter je nejstar a zjevn nejpvabnj (kapitola 12, tsn za zatkem):
"... a vidn jest jin div na nebi; a hle, Drak velik ryav, maje hlav sedm a rohuov deset; a na hlavch jeho sedm Korun a Vocasem svm strhl tet dl hvzd z nebe a svrhl je na zemi. A ten Drak stl ped enou, jen mla poroditi, aby kdyby porodila, Syna jejho seral.
.. a stal se boj velik na Nebi. Michal a Andl jeho bojovali s Drakem a Drak bojoval i Andl jeho; a nepemohli jsou, ani jest nalezeno msto jejich vce v nebi; i svren jest ten Drak velik Had star, kter slove Diabel a Satan, kter svod veken Svt; a svren jest na zemi; a Andl jeho s nm svreni jsou.".

3) Dost. Popemlet lze nad podobnost s Ancalagonem ernm... a kochat se renesann etinou... ale mn lo hlavn o oznaen draka, o kterm jsme mluvili, a je na prvn pohled vidt, e mnohohlav DRAK sv. Jana je souasn HADEM ze stvoen svta; a m svoje pekeln andly (!), take vechna ta slova nebyla zdaleka tak pevn, jak bychom oekvali. Reviduji tedy svoji glosu Elderovi - Zpad znal mnohohlavho draka, ale pesto na nj nemusel mt speciln slovo; kad vdl, e to je TEN drak (v Kosmovi obrat "zrdn onen had" - kad vzdlanec vdl, o co jde.)

4) Bez zajmavosti nen ani ikonografie. Monstrum se sedmi hlavami, deseti rohy a deseti korunami je naprosto nepehldnuteln; ostatn, v kapitole 13 nsleduje elma, podobn levhartovi, s medvdmi tlapami a lvmi tlamami, a opt se sedmi hlavami, deseti rohy a deseti korunami, a pak jet elma, podobn bernkovi, se dvma rohy, ale mluvila jako drak.
Co si s tm mli chudci ilustrtoi pot? Obligtn to eili sedmihlavm drakem, s hlavami, korunami a rohy nepehledn nacpanmi - vsledek je pozoruhodn okliv a nepoveden monstrum, vrn ilustrace Wothanovch filipik proti nect k realit. Ped elmou slo 2 kapitulovali skoro vichni a radi ji vynechali, vetn slovutnho Durera (Apocalypsis cum figuris, 1498).
Ne tak mj staten monogramista z Melantrichovy bible. Prvnm obrzkem pedvedl boj s drakem na nebi; na druhm vechny ti potvory; pak je tu jet vten nevstka Babylonsk na elm; drak vren do plamennho moe (kter milosrdn skrv zmaten poet hlav); a jet andl, kter klem zamyk draka v tom jezee (kouk z nj u jen jedna hlava, uff...)

5) Zvry z tohoto vletu jsou rozporn.... svat Jan, velmistr vech kouzelnk i theolog, se nm jako drakolog moc nevyznamenal. Jeho monstra jsou zjevn alegorick, sleduj jeho zhadn symbolick (a tak i politick, bohuel) linie, na prvn pohled je jasn, e tohle nikdy neilo a t nemlo... a mlem se to ned ani nakreslit. Ano, kdekdo to znal... ale myslm, e si s tm nikdo moc nevdl rady. Souvislost se "skutenmi" draky, nevm jak to ci lpe, je dost voln... snad ti Rusov...

Another cup of tea:
Pohled na vyobrazen Zlatho alte (polovina 9. stolet), kter mi vhodn pipomnl Wothan (jde o tu franskou korouhev - drak, nesen v ele vojska na tyi, ovem nevlaje, nbr tak kajc tr; je asi vycpan s njakou vnitn pte, aby byl lehk), mne vede ke zvltnm asociacm. Smysl tohoto draka neme bt heraldick; spe jde o to, vyvolat psychologick nznak, e drak let nad vojskem (nelze nevzpomenout na nai bitvu u Chlumce 1125!); je tam z pln stejnho dvodu, z jakho kreslili letci v druh svtov na letadla raloky... a jev tm znanou pbuznost s "lodnmi" draky Viking, kte maj stejn zastraovac el...

Take POZOR - dleit!!

1) Drak Frank i Viking se mi zd bt npadn pohansk... s tm biblickm (shora) nem lautr nic spolenho... a je-li drak pohansk, pak se nm cel kulturn mytologick teorie ots v zkladech (co vdli sta Germni/Keltov o antice...?)
2) Drakem lze vyhroovat, m-li reln zklad; nen dvodn si dt v elo vojska Janovo len monstrum; je ale dvodn si dt relnou potovru, jako medvda, lva, krokodla, nebo...
Divous31.3.2003 (9:27)
ARGO no, j si spe myslm, e na ostrov Patmos rostly zajmav houbiky :-)
Wothan31.3.2003 (10:06)
Ta citace ze Zjeven Janova - 12:

"A ukzalo se velik znamen na nebi: ena odn sluncem s mscem pod nohama a s korunou dvancti hvzd kolem hlavy. Ta ena byla thotn a kiela v bolestech, nebo pila jej hodina. Tu se ukzalo na nebi jin znamen: velik ohniv drak s deseti rohy a sedmi hlavami a na kad hlav ml krlovskou korunu. Ocasem smetl tetinu hvzd z nebe a svrhl je na zem."

Tenhle drak m 7 hlav a 10 roh...to mi njak netymuje, ale teba je ml na zdech jako stegosaurus tty :-) Ale jak pravil Argonaut - tohle je vn malsk rbus a obvm se e je prakticky neeiteln.
argonantus31.3.2003 (10:22)
Divous:
takhle jednodue bych to nevidl - mm sice vhrady keZjeven (viz Bh), ale na druh stran Jana dost ctm za evangelium... to rozhodn nebyl dn magor...

Wothan:
zejm cituje te ekumek. Prv, e na nkterch hlavch jsou dva rohy, a na nkterch jedna (a kroruny jsou navleeny na rozch, take nkdy i dv na hlav...) - nikdo jin to nevyeil lp. Prost prasrna. Vbec se nedivm, e mnohohlav draci nepirostli lidem k srdci...

oba:
za mnohem podstatnj povauji konec sv shodlouh glosy, kter se ve k t fransk standart...
Wothan31.3.2003 (10:48)
Argonaut: jinou citaci bohuel nemm, ale tam nikde nen napsno e m rohy na hlav - to e se to u pekelnho stvoen bere tak njak samosebou mi samosebou vbec nepipad, tob ano?
darkelf31.3.2003 (10:58)
Taky nco, co jssem nael doma v Besstich (opt bohuel v Humntin):

Wyvern: (nco mlo z humnsskch text)
- (heraldick drak Walesu, ale to ssp pro Divouse). Pvodn Wyvern ml pouze zadn nohy a msto pednch konetin blanit kdla. Bv povaovn jako ensk protjek drak (nco jako vrna a havran)
- Jinak jsou to vzdlen pbuzn drak, velc ltajc jeti s jedovatm ihadlem na ocase. Jsou 30 stop dlouz, ed a tmavohnd barvy, jenom pika ocasu je hol a podob se korpionmu. Koen kdla maj rozpt pes 50 stop. Ob elisti jsou vyplnny dlouhmi ostrmi zuby, oi jsou rud nebo oranov. Oproti drakm maj jen zadn nohy, kter pouvaj pi lovu jako dravci.
W.jsou sice hloup, ale zato vdy agresivn. to na vechno, co nen zjevn o mnoho silnj. Snese se z vin, popadne ob a ihadlem usmrt. Spry me toit jen pi toku z letu, pitom ale neme pout dn jin tok souasn.

Hydra: (a tu byla zmnn jakoto ssa) etl jssem, e tento tvor me mt ssouvisslosst ss krakaticemi (ta voda a
d.) a proto povauji za Ssan neltajc draky ss jednou hlavou. Vcehlavosst dra sse mi prosst p.

Dal tvorov, co maj co ss draky do inn:

- Tiamat: Babylonsk Had Matka Boh
- Ngov: Tajemn indick had nrod
- Mo-o: polynzky drak kradouc stice
- Gargouillov: podivn mal kamen draci
argonantus31.3.2003 (12:33)
Wothan:
no, vem mm ilustrtorm (vetn jednoho ze 14. stolet) to samozejm pipadalo. Jinak ty rohy (ostny), o kterch jsme ji mluvili na Elfech, jsou zase samostatn problm... ten bych te jet odloil (dra heben)

Ale co ty na moji teorii zastraovn 29.3. dole, a zejmna npad, e draci jsou vlastn pohant? Nen to dost velk dra do naich pejmacch mytologickch teori?
argonantus31.3.2003 (12:39)
Darkelf:

jen glosy - wywern je walesk slovo, nebo jak..? kde jsi to vzal?

- hydra - mm dojem, e se nm zadnmi vrtky vrac chobotnice, beholder a Cthulhu... jinak npad na souvisost hydry a krakatice je geniln. Kdo na to piel?

- k nelibosti nad vcehlavmi draky jsme se hlsili skoro vichni. Zvlt, kdy jejich pravzor je Janv paskvil... a hydra mon drak vbec nen...

- Tiamat je tet sefira, przdno, vlastn gravitace. Alespo jak jsem pochopil pvodn prameny (Gilgame). To bych sem netahal.

- Ngov: ngy znm taky; opt poukazuji na podivnou zlibu Ind (a potamo Slovan) mnohohlavosti... dal potek npadu na sa?

- Mo-o: o tom vm houby

- Gargoyl: kamenn chrli; zjevn novodob zpracovn stedovkho artefaktu; s draky opt souvis jen voln )drak - chli, sekundrn zpracovan v potvoru)
Divous31.3.2003 (12:41)
prost pt hlav mlo dva rohy a dv hlavy dn, a nebo tyi hlavy roh jeden a ti hlavy rohy dva...jasn jak facka
darkelf31.3.2003 (12:49)
Argoantus: etl jssem to v jednom besstii! Ani nevm, je to mylenka, ale docela m zarazila, e m to nenapadlo dv (kterpak zve m hodn hlav)
darkelf31.3.2003 (12:50)
Divous: Nemohl by jssi sse kouknout na toho Wyverna vs. Wales (v rovin heraldiky)?
darkelf31.3.2003 (13:04)
V anglickm jazyce maj taky dva druhy drak:
a) dragon (okdlen)
b) Drake (bez kdel)
argonantus31.3.2003 (13:20)
Darkelf:
dragon versus drake - zadej bli informace - odkdy to tak m bt... napklad dichotomiemezi san a drakem, kter se nm jevila bt s Divousem na potku jasn, je te m dl tm nejasnj

jinak i tob mj odkaz na 29.3. na konci - povauji tuhle mylenku za dost zsadn; pokud najdeme draky na vc mstech, kde o sob nevdli, budou mt dokazovai jejich neexistence docela problm...
Wothan31.3.2003 (13:37)
Dark: ctyhodn...to muselo dt dost prce se slovnkem ne? :-) Je hezk jak jsi tam vpaoval svj jazyk :-)
darkelf31.3.2003 (13:38)
Wothan: Kdy v co hledat a kde, tak najde vc!!!

Jinak dal associace: Drak vs. Kometa
Fanda31.3.2003 (13:55)
Darklef: Ta jugoslbsk Zmaj mi nkaj evokuje zmiji (jednovatho hada)...

Jinak m napadlo k tm japoncm, e to, e pevzali anglick nzev pro draka by mohlo znait, e ct jist rozdl mezi drakem, tak, jak je znm v Evrop, a svm ryuu.
argonantus31.3.2003 (15:07)

velkolep vlov jazykovdn... potvrzuje nae laick tvrzen, e slovo drak (nebo takov njak zklad) je rozen pmo zbsile

odchylky rostou se vzdlenost (co asi nikoho nepekvapuje) a se stm jazyk (Aljaka ?, Havaj ? - ertv, kdy a odkud to slovo mohl nkdo dovzt)
skuten divn jsou ty odchylky ve vchodn Evrop (zmaj je ta druh, hadovit parta slov - ssnake, ssmok, vak vte...)

ale jet jednou se dovolvm - co, jestli znali Keltov a Germni (u tch to tak vypad) draka ped pchodem kesanstv (eho se lze nadt?) Kde se to potom u nich vzalo?
Wothan31.3.2003 (15:39)
Argonautus: myslm Germni e znali - ta zmnn povst o Sigurdovi je sice zapsna a pozdji, ale je mnohem star a bez draka by postrdala smysl.
Divous1.4.2003 (7:23)
no, ten popis wyverna docela sed na heraldickho draka, zajmav je ten jedovat osten na konci ocasu, ten m heraldick drak taky
argonantus1.4.2003 (9:06)
Divous:
tohle jsem si taky nikdy neuvdomil...
jinak - heraldickho draka znm z rznch teoretickch knek (Schwarzenberga, Zengera, Bubna, snad je i v Krlovi z Dobr Vody) - ale vechno jsou to vlastn dost modern prameny... a kdy se pak lovk zahled peliv na opravdov star draky, shled asto nco dost jinho (to Vysok Mto - u jsem vidl i dal verzi ze14. stolet - na obou je drak spe anatomick, ne heraldick; nem dn jedovat p, dn ohe...)
ostatn, dokladem jsou i tebou uvdn Kunvaldov (Vradov a Drait) - jednak je to, tum, 15. stolet; jednak se v popisemch neustle plete drak a baziliek...

Wothan:
1) Nai mytologit draci nechrl ohe zruba do roku 1200 - nen -li pravda?
2) Zdrcujc vtina jich nem vce hlav (vjimky jsou jasn vymezen - drak Janv)
3) Nai mytologit draci jsou zejm star, ne kesanstv, a tud i psmo (Ffnir, ale s nm hrozn dvno zpasil i Thor, ne? Merlinovi draci pod Vortigernovou v; a hlavn - nkde najdu ten obrzek keltsk duhovky s drakem...)
4) Draci jsou uvn jako symbol sly, nebezpe; v boji posiluj vlastn jednotky a zastrauj neptele (trochu jako drpy a zuby na krku)

a te u si nejsem tak jist:
5) Draci jsou relnj a samozejmj na severu Evropy, ne na jihu
6) Pokud je to vechno tak, museli si je vymyslet nkde na severu Evropy nezvisle na dracch vchodu... a nebo...
Divous1.4.2003 (9:20)
ARGO o ast zmn drak-baziliek jsem psal tak v tom lnku o dacch na erbech.
Osobn to rozliuji tak, e heraldick drak m mt dv nohy a had tlo, baziliek takt ale hlavu kohouta a sa m tlo jetra a nohy tyi. Samozejm to ale 100% neplat, zmatek je v heraldice dosti velk co se tchto potvor te.
Zrovna ale to Vysok Mto mlo na pvodn peeti draka dvounohho. Proto jsem i na svm ilustraci souasnho znaku Vysokho Mta nakreslil dvounohho draka s hadm tlem, i kdy msto dnes uv draka tynohho. Toto pidn noh nepovauji v ppad vsokho Mta za akceptovateln, kdy existuje dochovan doklad o "dvounohosti" !
Pro zmnu ale u Trutnova jsem nechal "jetrku", protoe i dochovan peeti mli tynohou sa (i kdy v popisu znaku se dotete, e sejedn o draka :-))
Wothan1.4.2003 (9:35)
Argonaut: bh Thor bojoval s Midgardsormrem - toho popisuj mta sp jako moskho hada obepnajcho zemi lid. Thor s nm zpasil celkem dvakrt - jednou jej ulovil na b hlavu, ale netvor mu unikl. Podruh se s nm setkal (nebo setk? :-) ) v Posledn den - v den Ragnarku a zabil ho, ale sm podlehl Midgardsormrov jedu, nebo jak prav

54. strofa Voluspa (Vdmina pse):

Tu proti netvoru
pichz slavn
Hldynin syn
bt ses hadem.
Podlehne sani
pln zloby
mocn ochrnce
celho Midgardu
- muov domovy
opustit mus -
devt krok st
drakovi uhnul Fjrgynin syn,
bez hany vldce.

Je zajmav e i kdy se bn mluv o Midgardsrormrovi jako o hadu i netvoru, v Hegerov pekladu je pouit pojem "drak". Hegera bych z neznalosti nepodezval ani nhodou, take je to asi zase otzka vkladu pojmu. Podvm se jak to znlo v originle.
Wothan1.4.2003 (9:37)
Ostatn v tme pekladu jen na 48. strof se jasn mluv o Hadu...asi to skuten nerozliovali.

Moje nejoblbenj strofa je ale 55-t:

Slunce se tm,
v moi zem tone,
do hlubin padaj
hoc hvzdy,
plameny cel svt
pohlcuj,
sah r ohn
k sammu nebi.
argonantus1.4.2003 (9:50)
Divous:
k dvounohm - tynohm drakm pipomnm svoje dvn 27.2. v 9.31 - povauji z rnch dobrch dvod dvounohou verzi za logitj a pvodn star, i kdy v souasn fantasy pohchu tynoz draci vtz na cel e...

To Vysok Mto mi hraje do noty; a Wothanem pipomenut korouhev taky (Wothane - fakt nevlaje; tr)
argonantus1.4.2003 (9:58)
Wothan:
nejistota ohledn rozdlu mezi drakem a hadem tu u byla mnohokrt... napklad u toho Jana (kde je monstrum navc vcehlav)...

Kruhem se vracm k jedn z prvnch otzek, kterou jsme tu u eili - odkdy draci ltaj? Automaticky jsem povaoval ltn draka za jeho podstatn znak; bez nj se toti stane hadem (narozdl od potu nohou, ohn, nzor na poezii, bez kterch se drak nakonec obejde).
V m dost star (a bohuel pozd zapsan seversk mytologii) draci ltaj ve vtin ppad...
Wothan1.4.2003 (10:30)
Argonaut: to nic neznamen - to me bt stylizace - prapory a korouhve se v tomhle obdob taky nezobrazuj plastick a vlajc, ale trc, rozvinut jako bys je nakrobil :-) Myslm, e plastick byla jen pedn st draka - musela kvli usazen na er, ale tlo asi ne - navc by bylo mnohem psobivj ji nechat vlt - tak se to tak obvykle vykld v rekonstrukcch z pvodnho vyobrazen - nco ti polu. Ono kdyby to bylo pevn tak by to asi bylo ponkud nevyven, pro jezdce co to m na erdi nesmrn nepjemn k manipulaci (pka ocasu v pomru k hlav) apod. Skuten pevn byla jen pvodn signa militaria man (pochopiteln vexillum ne) - take ten drak (draconarium - jedna z variant signa kohorty) byl nepomrn men - asi ve velikosti jak ml manus, nejsp tak men ne aquila.
argonantus1.4.2003 (10:44)
Wothan:
mne jen zaujalo, e ten drak ve Zlatm alti je upevnn nkde ve tetin dlky, ne-li v polovin - tak jakpak pka... a jak, medle, by mohla bt ta st tla jen textiln, kdy tam je to upevnn?

to je ale problm soudobho konstruktra living history - mne sp zajm ten psychologick moment, e drak m vzbuzovat asociaci reality... pinejmenm podprahov a magicky

k souasn evergreenov otzce - ltaj tihle draci na korouhvch? kdla mus mt dost zakrsl, u z tch konstruknch dvod.. ale maj je vbec?
Divous1.4.2003 (11:03)
ARGO naprost souhlas. Drak tolik rozen ve fantasy-nru (a jeho vzhled povauji za asijskho hybrida, viz mj lnek v Pevnosti) , kter m 4 nohy a jet navc jeden pr kdel, tedy tvor se 3 pry konetin je naprost biologick nesmysl. Vdy by to ml bt 4-noec a pedn pr konetin je bu prem konetin nebo je pemnn v blanit kdla - viz draci ve filmu Reign of fire, kte se mi velmi lbily.
ili i heraldick sa by mla bt kreslena bez kdel, i kdy vtinou nen
Divous1.4.2003 (11:05)
ukate mi v prod ivoicha vyho du (od obojivelnk ve) kter m 4 pry konetin a jet kdla
elder1.4.2003 (11:13)
darkelf - k tomu zoznamu:
Padm na zadok! Prezra, odkia si to vetko vyhrabal?
Ten srbsk a juhoslovansk (aj slovensk? Nikdy som sa s tm nestretol) zmaj sa mi celkom pozdva aj ke to zrejme bude t zmija ako psal Fanda.
Dos z tch nzvov by si zaslili podrobnej etymologick rozbor. Ak si njdem as na zopr sa pozriem. V tej grtine mi chba ten derkesthai. Dnes si asi pjdem kpi grcky slovnk (na nete som ni poriadne nenaiel) a uvidm o vyptram.
Wothan1.4.2003 (11:20)
Argobaut: tch vyobrazen je mnohem vc. J mm pedstavu (a podotkm e je to jen odhad, spekulace - pravdu se u dneska asi tko dozvme) a u jsem to i psal - e hlava a hru draka bude plastick - tj. nejsp ze deva. Ta je taky upevnna na t erdi. st tla a ocas je ale podle mne textiln a vlaje ve vtru.
Fanda1.4.2003 (12:00)
Divous:
Tak o tomhle jsem psal u nkdy na zatku diskuze - mezi suchozemskmi obratlovci vskutku nenajde ivoicha, kter by ml 6 pr konetin - obas se sice takovho narod, ale hned to ume, tud se d tato mutace pokldat za letln a nen se co divit, e se nic takovho nevyvinulo. No, popravd, tahle "tvernohost" je vlastn i u ryb a paryb.
A pokud jde o hmyz kdla (pi jen tak pro zajmavost), tak to je vlastn horn st (exopod) kriv konetiny, jen je to zanoen do tla a tak to dl dojem "dvou nezvislch vrpstk na jednom lnku" - jen podotkm, e hmyz m krivch nohou 3 pry, piem kdla jsou na 2. a 3. (to abych pedeel nkterm nedorozumnm).

Pokud jde o tu ltavost, tak mm takov pocit, e Vchodn draci nco takovho jako kdla vbec nepotebuj (tak se vm zd, e ti ikmooc blc maj njakou vt fantasii - my Evropan, kdy chceme nco rozltat, tak tomu musme montovat kdla...)

A ad ta vcehlavost - jako se narod tu a tam nco s vce konetinami, narod se obas i nco s vce hlavami (sm jsem vidl dvouhlav, estinoh tele - zemelo krtce po porodu, pochopiteln) - jene u had se obas narod dvouhlav jedinec, kter JE ivotaschopn! e jsem si na to nevzpomnl dv!
argonantus1.4.2003 (12:05)
Wothan:
nepu se - m urit vc podklad. Mj dojem vychzel z jedinho obrzku (jen pro plnost - a o kdy to dlali rzn nrody rzn...?)

lo mi o ten psychologick moment vrohodnosti draka, kter je u t korouhve dleit (a souvisejc s lodmi viking a se raloky na letadlech druh svtov...)

Divous:
docela by nm pomohl njak hodn star tambuch, teba francouzsk nebo anglick... j jsem nikdy nic takovho nestudoval... nev o nem podobnm na netu?

Elder:
objednal jsem u vagrov dotaz stran toho indickho pvodu slova drak... uvidme, co to udl
- jinak - co k problmu wyverna? na mn to dl dojem ehosi keltskho - ale jsem laik

Vichni:
na svoji dleitou otzku - odkdy draci ltaj - odpovdm sm, e minimln od roku 1130, kdy ltal s naprostou samozejmost ten kanovnkv drak...
argonantus1.4.2003 (12:20)
Fanda:
m raztko s drkem za ty dvouhlav hady - myslel jsem na n celou dobu, ale narozdl od tebe jsem nebyl schopen ci, m jsou zajmav a dleit... tohle je samozejm mon zdroj mytologickch vah o vcehlavosti - mohli si toho vimnout u hodn dvno (a nepovauji za nhodu, e z naich vlov vylezli vcehlav hadi o hodn dve, ne draci- viz ta hydra - povimni si ovem jet Darkelfova objevu s krakatic)

jinak - mylenka ltn vchodnch drak je pro mne straliv zhada... pijmu-li jako jeden z velmi mocnch zdroj mtu opt toho Darkelfova vchodnho manka nad kostrou (pesnji pte) velkho sauropoda, pak mi prozra, jako kovan otaku,
PRO KSAKRU TOHLE MONSTRUM MLO JEt KE VEMU LTAT!
argonantus1.4.2003 (12:31)
Fanda:

off topic - neodpustm si k t vchodn fantazii - my ze Zpadu sice nemme tolik fantazie, ale mme rzn wothanovsk koumky, kte si daj zleet, aby to fakt fungovalo.
Proto se Vchod povznesl ke kung-fu a podobnm vzneenm vcem, kdeto poklesl a primitivn Zpad naped zapancoval manky do kovu a dal jim mee, a nakonec to skonilo u tomahawku, navdnho z druice...

n primitivn zpadn drak potebuje k ltn kdla, ale j nevyluuji monost, e fakt ltal...
Divous1.4.2003 (12:34)
von mon kdla neml ani ten pvodn Evropsk ale protoe prost lovk z prody vdl, e bez kdel neme nic ltat, sm mu je pisoudil
argonantus1.4.2003 (12:57)
Divous:
tohle prv je kardinln otzka; stoj na n provokativn mylenka, kterou jsem tohle cel vlastn rozpoutal (26.2. rno + glosa veer 25.2.), veden k tomu dnes ji legendrn tzkou jistho Anonyma.

Jsou v zsad mon dv verze:
A) - draci vznikli v mytologii krotkou evoluc z had (dn mytologicky zvtnch) - tak njak by si to pla oficiln vda

B) - draci byli ltav od potku; neb to je peiv pterosaurus, kter se motal lidskmi djinami pohansk Evropy v pustch severnch oblastech (a mon na pobech) k uritmu zden svch souasnk, ne nepodobni tm Nohm o pr glos doleji; a potom se z djin tie vytratili - (nejpravdpodobnji s rozvojem zemdlstv ve stedovku). Tak bych to vidl j.
A uznvm, e konen dkaz nemm. Jen mi to pipad bt nejelegantnj vysvtlen minimln celoevropsk (a ne-li celosvtov) dra mnie (a tak podivn biologick smysluplnosti zkladn ideje draka, kter u vtiny jinch mytologickch nestvr absentuje).
Darkelf1.4.2003 (14:01)
Elder: nejen sstar maj zdroje. Jssem na ssti.....WE ARE BORGS
Darkelf1.4.2003 (14:04)
esst nohou, pro ne?! Kde berete tu jisstotu, proboha.
argonantus1.4.2003 (14:44)
Darkelf:
nae jistota plyne z empirie a z technickho poznn evoluce. J bych na to vsadil. Byl-li drak, pak byl dvojnoh. Nebyl-li, pak je to jedno.

Jinak radm odboit - u se zase tme k obhajob pravdpodobn reality proti nepravdpodobn, a u to zan bt trochu proflknut...
Darkelf1.4.2003 (14:50)
Argonantus: Dobe, j do toho mluvit nebudu. M draci maj esst noh, vy ssi bhejte za Wyverny "-(
Wothan1.4.2003 (14:51)
Kdy me mt k 8 :-))
argonantus1.4.2003 (15:15)
Vem:

dl hledm hodn star ltac draky... WANTED!
Wothan1.4.2003 (15:26)
koda e jsem ho vyhodil...byl oprvadu star :-) Jak star je vlastn tradice poutn drak? :-))
Fanda1.4.2003 (15:30)
Argonantus: Popravd eeno opravdu nevm (i pes vekerou snahu stle zcela jako Asiat nemyslm ^_^), jak pili na to ltn bez kdel, ale asi to bude tm, e v Asii doke ltat cokoli, co je dostaten mocn, cokoli, co se doke "povznst" nad normln svt - bjnmi mistry bojovch umn ponaje a draky a bohy kone.
Krakatice - nevm, ale krakatice je dosti hlubiin tvor a takovou hloubku ve Stedozemnm moi nemme (+- 1 km), ovem moe mohlo vrvhnout cokoli. Pak by muselo dojt k zmn hlav za chapadla....
Tvj sen o pterosaurovi me bt pravdiv (a lochneska by zase mohla bt plesiosaurus - HA, dal "drakoid") - fosiln zznam je dosti drav a teba chudinku latimrii nenali cel tetihory - nezbv ne ekat, ale kdyby se nco nalo, snad by to mohlo mnoh vysvtlit, kdo v - zatm zbvaj jen ti hadi.

Divous: to znamen, e prost lovk stedovk Evropy byl tupj ne prost lovk z ny ^_^

Darkelf: Chce-li se dost, pro ne 6, odkazuji na nkter z mch rannch pzpvk. Neznm vrazy pochopiteln na podn vyssvtlm ~_^
Samozejm to ale nen dvod k tomu, aby ti Tvoji draci 6 konetin nemli.
argonantus1.4.2003 (15:32)
Wothan:
vypad to njak nsky... i kdy pedstava kanovnka Vyehradskho, kter si vyrb draky a pout je nad Vyehradem, je taky pkn (bylo by mu to podobn).
jinak - pro kme tomuhle drakovi z papru drak, kdy teba pro angliany je to kite?
Wothan1.4.2003 (15:44)
Argonaut: hmm, aha, odtud vchodn vtr zd se vane. Jinak v etin je drak i kostra - konstrukce. Ale to asi bude dsledek tch paprovch.
argonantus1.4.2003 (15:49)
Fanda:
tohle je dost dobr, co k; vchodn mudrc dumal nad ltnm jako takovm; take vymyslel levitaci; zpadn technokrat koumal nad kdly (take dospl k letadlu, ale jet mu to dost trvalo). To bych asi bral.

pak je tu jet tet verze s tmi opeenmi hady z Ameriky - ale piznm se, e na to nemm.

Pokud nkdo zmioval draky v Indonsii, tam jsou varani a krokodli... draci by tam byli zajmav opt pouze v ppad, e ltaj.

Jinak - Fando, pora - co je pro draka lep biotop - les, pobe, nebo bainy? V Evrop mme k dispozici lecos...
Fanda1.4.2003 (17:46)
Argonantus:
OK, vezmme tedy takovho draka evropskho (Draco europaneus), evolun vzniklho - mon tedy nco jako ptakojetra, masoravho, anto je to velik a lt to (a o bloravm drakovi jsem neslyel)
Je to velk a m to velk kdla, take aktivn let u toho nepipad v vahu - bylo by to moc namhav. Take to mus vyuvat termiky a stoupavch vzdunch proud, aby se to vzneslo - take hory, potamo velehory, aby tam bylo dostatek monost k hnzdn (jeskyn a tak). Zde by mohl lovit kamzky, horolezce a snad i orly, pop. by se mohl poutt i dl - vlastn nemohlo - muselo by to lovit na oteven krajin (horsk louky, ovem sekundrn tak pole) - pochybuji, e by to jen tak vltlo do les a riskovalo to porann kdel a hlavn by se to pak patn vznelo. Svou koist by musel chytat v letu, pop. by ji mohl naped usmrtit vyplivnutm toho jedu (ale nemyslm si, e by ho ke sv velikosti poteboval) a pak sebrat (opt v letu) mrinu. V dob je by muselo bt chvatn sledovat zpasc samce, jak ve vzdun akrobacii do sebe tluou kyjovitmi konci svch ocas (to ten "trovit ocas") ve snaze srazit svho soka na zem.
Pedpokldn vskyt: Alpy, Karpaty, Pyreneje. Mon by mohl na zimu migrovat do zimovi na Atlasu.

Pochpopiteln by byl mon i o nco subtilnj pbuzn (Draco europaneus ssp. britanicus), kter by sdlil nad skalnmi tesy u moe a vyuval stoupavch vzdunch proud pi pobe. Ml by u kdla a tlamu a mohl by lovit tebas delfny. Jestli by byla konstrukn mon varianta ala albatros vyuvajc vtrnho proudu nad vlnami, si netroufm ci.

Toto ale vztahuje jen na draky okdlen - by-li li by neokdlen, tak teoreticky kdekoli, jen je otzka, jak a co by lovili - pi jejich velikosti mi tvan nepijde jako dobr strategie (a jakmile by potkali les, byli by v koncch) - pravdpodobn by se jednalo o hajcho lovce - take pak klidn ty slatiny, pop. vodn plochy - kdy to tak po sob tu, je to krokodl.
argonantus1.4.2003 (19:49)

Darkelf:
na tv vslovn pn pr poznmek o sv. Jim.
Ve stedovku jeden z nejslavnjch svtc. Ml pr t nkdy ve 3. nebo 4. stolet coby ryt z Kappadocie, kter zachrnil v Libyi (!) v mst Silene njakou dvku ped drakem a obrtil tak na vru tisce lid. Pak psobil v Palestin, kde po mnoha divech, je mu pipisuje stedovk tradice (Legenda Aurea hlavn) byl v Nikomdii muen a nakonec popraven z vle Dioklecina. Historka s drakem je neslavnj st (pozdn, katalnskou verzi m jet mj Montse Saint); a tak nejastji zobrazovna. Vyuitm draho kouzla (toti - pitalivosti draka, o n nikdo z ns diskutujcch neme rozumn pochybovat) se Ji stal vjimen tm, e je svtec oblben na Zpad (patron Anglie, slavn u ped pchodem Norman) i Vchod, a nen apotolem nebo nco podobnho. O jeho podivn loze u ns viz mj lnek, kter snad vyjde v Pevnosti. Ikonograficky je prakticky vdy zachycena ta drakobijn scna; a Ji skoro vdy bod draka do tlamy (viz Wothanburg.cz)
V tomto wothanburskm lnku je jet dal zajmav dra svat - Markta Antiochijsk, kter si odmtla vzt pohana (obvykl kli), ale za to byla pedhozena a nakonec serna drakem (!).
Tet dra svat je archandl Michael - ten je ale pehledn jako Nuselsk most; ve o nm bylo eeno v pasi o Janovi a Zjeven.
Za zmnku stoj jet pask biskup Marcel, kter pr zahnal draka berlou, a je vyobrazen v Notre Dame.
Vrtm-li se k Jimu, co je asi nejslavnj verze archetypu I, pak v tom bv vidna velmi asto crkev, pemhajc pohanstv (tma u rannch kestan neobyejn aktuln a atraktivn); take vidn Darkelfovo draka coby "velik ssly, jen tresst" - i kdy bez t prody - nen tak pln od vci... a pijde mi dokonce jet star a hlub vrstvou, ne ten Satan.

Konen zbv zmnit mj dal experiment, jeho clem bylo zjistit, zda m kdla drak na nebesch. Odpovd je zase dvojznan:
1) V na, dnen (eck) verzi drak kdla nem
2) jene postaven nanicovatho souhvzd Cephea, kter mohlo bt klidn dve soust Draka, by mu zase kdla dvalo...
argonantus2.4.2003 (10:15)
Fanda:
Tak, te jsi uinil dal vc, kterou jsme asi mli udlat u dvno. Mate mne, e nae mytologick zprvy tak njak nekoresponduj s tm, co jsi ekl... a nebo jim sp patn rozumm.

1) Latinsk nzev draka - mn se lb; poznamenvm jen, e Montse Saint se tudy u vydal, a dopadlo to jinak; vytvoil Velkho draka pozemnho (draco rex crispus, tum), draka vodnho (draco splendens), a draka ohnivho (zapomnl jsem jmno) a jeho dva poddruhy.

2) Aktivn let; a jsme zase u toho; te u jsem ale chytej, a vm, e jsme v zajet modernho mtu dinosaur. Pro jinak by se v Montse Saintovi objevila vta, e "drak je homoiotermn plaz"?
Dv se na to kalalo, a mne te napad dleit vc - pi velikosti draka lze dvodn pedpokldat, e drak lt jedinm pro tuto velikost ovenm zpsobem - nemv kdly skoro vbec, jako vtro (stejn jako orel nebo albatros); problm aktivnho letu se me soustedit maximln na otzku startu a nabrn vky (bu se spout ze skaliska jako rogalo, nebo pece jen prkrt mvne). To lze nesnadno rozhodnout; pipadne mi, e homoiothermie by drakovi pinesla vc starost, ne uitku (ohromn srdce, spoteba potravy atd. - ve se to nekonen e u tch dinosaur). Navc dnes u tume nkter pechodn monosti, kter se nm moc nedochovaly.

3) Homoiothermie - kterou bych pipustil maximln njak neplnou - m vliv na mnohem dleitj vc, ne zpsob letu - na drakovo rozen. Myslm, e meme s klidem odmtnout draky za polrnm kruhem (s plazy to na severu za moc nestoj, a je jasn, pro). Problm - pro je tedy drak tak hrozn oblben v Norsku? Jde jen o jin polovinu zem (kde to trochu zachrauje Golfsk proud?) A taky to podle mne komplikuje spnost drak v Alpch (kde o nich, mimochodem, zprvy moc nejsou).


4) Je to velk... mimochodem, jak moc velik? Mne pijde tch tradinch ticet metr nesmysl - co by to lovilo? Slony? J bych osobn neel nad velikost pteranodona (osm metr rozpt, ale jen asi metrk vhy, a mon ani ne...); tak njak mi naskakuj rzn drakobijn obrzky, a na nich jsou draci - soud podle velikosti drakobijc, ppadn kon - ve velikosti dov metr (tipnul bych to od t do pti...)
Vm, e existovali pterosaui vt (viz mj namibijsk odkaz), ale africk proda je pece jen o dost vkonnj, co se te zdroj potravy...

5) Hory k ltn - tady vidm pot. Ty velehory by psobily zmnn pote s teplotou (pro nae ely zejmna Alpy nebo Kavkaz). Mal hory - napklad esk - jsou zase pln strom. Take se nm mnostv vhodnch hor hodn redukuje... ale zase to nen tak beznadjn - napklad mne napad nae Stedoho, Harz, Kaledonsk vysoina a podobn tvary...

6) Problm s lesem. Potvrdil jsi moje nejhor obavy. krtm velkou vtinu Evropsk mapy. V echch nm zbv vlastn jen ta Polabsk rovina, vhodn doplnn tm stedohom (take by ke stetm lid a drak dolo zejm dost brzy, s fatlnm vsledkem pro draky... ten kanovnkv drak roku 1138 mohl bt klidn taky posledn...)

7) Pobe. To by mohl bt dus ex machina. Jestli mme v Evrop neho pekvapiv hodn, pak je to pobe (snad dn kontinent nem tak sloit tvar). A tady je mon ve, co je poteba; skly k rozletu a hnzdn; spousta rznorod potravy (z moe i t ze zem, co se zala na pobe podvat. Delfn je sakra velik. Mn by staila dorda, tuk nebo tak nco). To by dojist mry rehabilitovalo to Norsko.

Problm. Pro jen se mi zd, e zprvy o dracch maj tit v severnj, Atlantsk sti Evropy; narozdl od zprv Stedomoskch, kter jsou divn a zmaten (ti ekov, kte nejsou to podn odliit hada a draka?)
Je to jen mj dojem, e civilizace, en z Egypta (a bez drak), narazila pozdji v ecku na zprvy o dracch, se ktermi si moc nevdla rady (neb draci byli jet severnji?)
Mohlo by to souviset s tm, e Stedozemn moe bylo civilizovan mnohem dv; take ppadn draky vyhubilo u v pravku...?

8) Bainy. Ty bainy mi vrtaj v hlav z pvodn verze Dimophodona. Mme v Evrop bainy - zejmna v Blorusku a Litv a okol; a je to len dra mlem dodnes; je tu ale opan paradox - zprv je odtud tak mlo, e se mon nedochovaly... (prvn litevsk psemn pamtky jsou pr z potku 14. solet). To u by to mlo bt s draky velmi nahnut...

9) hajc lovec - nejsem si jist, jestli je to provediteln s nm ltacm tto velikosti. Jinak ti krokodli nm v tom dlaj bordel od potku (ta seran svat Markta podle mne souvis sp s krokodlem).
Sp bych se dval na ty Wothanovy kormorny, orly mosk a podobn vci...

10) Navc mne napad, e nlezy pterosaur jsou na potvou nejastj v Evrop. Me za to mon kvalitn fosiln zznam; nebo to, e je tu nejvc archeolog; ale je to tak. Konkuruje jen Severn Amerika (opeen had?? - tady jsem se piznal mnohokrt k bezradnosti).
A nsk draky bez tebe, Fando, nerozsvtme. Nemm ani pont, odkdy ty jejich dra mty vlastn funguj. Maj ani nebeskho draka?
argonantus2.4.2003 (10:22)
Elder:
tady moc nemm, co bych dodal. Zaujalo mne:
- vivern - vysvtluje Divousovu poznmku o podobnosti s heraldickm drakem - to JE heradick drak; a opt od renesance (jak je to dozadu, marn hdm - ten atraktivn kyjovit ocas, popsan Fandou, me bt nov npad)

- sanskrt - DARC. Take JE takov indoevropsk slovo; m se ale za to, e znamen nco jinho. Pozorovat, bt na stri - to nen patn (bt na stri ped draky?). Tak mon vidt draka - asnout. Vyvolv to vc otzek, ne odpovd.
Fanda2.4.2003 (13:17)
Argonantus:
Nejprve mal poznmka k tomu, cos odpovdal Elderovi - ono to "pozorovat, byt na stri" nakrsn me souviset s funkc draka jakoto strce (poklad a jinch vc).

No a te k tomu mmu popisu:
- ten hajc lovec byl mylen pro tu bezkdlou formu
- na tom letu se asi shodneme
- otzka teplokrevnosti (homoiotermie) je zhadou i u tch dinosaur - osobn se piklnm k tomu, e rozhodn drav terapodi byli endotermn homoiotermov (stl teplota a sami si vyrb dostatek tepla), velc sauropodi pravdpodobn exotermn homoiotermov (stl teplota, ovem teplo pijmaj z vnjku, co je umonno jejich velikost - k se tomu tum gigantotermie). Problm m ale s tm aktivnm letem - veobecn se soud, e k tomu, aby zve mohlo ltat (a ne jen padkov plachtit) je ona "teplokrevnost" nezbytn a tum, e ani u tch pterosaur o n tm nikdo nepochybuje (teda a na tu sekernatku, ale ta nebude ltat moc dlouho a navc nevm pesn, jak to m ta udlan s obhem, krom toho jej tlo je nco mnohem menho a je-li to tropick ryba, co myslm e je, tak tam by ty vody mohly bt docela tepl) - ono i to plachtn je sakra nron vc (zkus dret ruce 2 hodiny rozpaen a uvid sm). Krom toho pi t velikosti nkolika metr (na kter bych se s tebou shodnul) by to nemuselo bt tak stran. A ta velikost srdce? I di ty - kdyby ve zviselo jen na srdci, jak velk by ho asi musela mt takov irafa? (zd se mi to, nebo nar na ten lnek z National Geografic?)
Dle mho, byl-li by drak, ml by bt homiotermn a velmi pravdpodobn i endotermn. Pravdpodobn by pak ale musel mt njak zazen v tepnch vedoucch do krku - bu tepajc arterie (jaksi "pdatn srdce", nebo zklopky, jako to m irafa). No a kdyby na zimu migroval, odpadli by ti ty problmy se zimou na velehorch v zim.
argonantus2.4.2003 (13:32)
Fanda:
dky za mnohem odbornj vysvtlen homoiotermie - asi m pravdu. Zvrem je ovem urit zven ravost draka ve srovnn s jinmi plazy podobn velikosti (o em podle mt, mimochodem, nen pochyb).

migrace - jo, to mne nenapadlo; a jet mme v zloze zimn spnek, kter by nm eil pote s msty, kde jsou velk vchylky teplot (ty severovchodn bainy)

ad zbytek mho desatera:

5) a 6) - z irho vlastenectv (nevdeckho) - co k tomu Stedoho, odkud se spout draci na polabskou rovinu, aby tam pepadali neboh rolnky?

7) Co k pobe? Jev se mi bt velmi dleit... speciln - co s Britni nebo Norskem?

8) Co k severovchodn bain? Nen tam zima?

10) Trv - Maj ani nebeskho draka?
argonantus2.4.2003 (13:53)

Ptel, stran dal vznamn blc se mety - technick dotaz:

Nemme zaloit Draky II? Nebrnme lenou dlkou fra jinm v diskusi?
A nebo naopak peruenm zrume kouzlo?

kdo chce, a ekne nzor - j nevm...
Jirka2.4.2003 (14:24)
J nejsem velk expert na slovansk draky, jen jsem nco o tom etl. Drak byl nejsp pro Slovany symbolem sly, co sten spojovali s plodnost.

Jirka
argonantus2.4.2003 (14:26)
Jirka:
dkuji za bleskovou odpov. Nicmn- kde jsi to etl?
Darkelf2.4.2003 (14:43)
Argonantus: Do ptisstovky a pak draky II, m sse to u zd taky dlouh. Jinak by nkdo mohl udlat pehledn vtah a obssah drak I.
Darkelf2.4.2003 (14:50)
Fanda (znovu esst nohou): Tohle ssamozejm dvod nen. Ty uvauje pouze o tom, e zamn geny pouze v jedn ssti. ale co kdy zmna gen probh i na jinch sstech DNA (proto je DNA tak variabiln - jinak o exonech a intronech sse bavit nebudu, ve kole toho mm a nad hlavu...tedy jesstli byss kal, e u sse nov geny nemaj kam vlzt)
A jet jinak: Pokud by jssi byl hmyzk nebo houba ss rozumem, taky by jssi urit zavrhoval tynoh organissmy (ale geny do toho netahej, tm nerozum nikdo! a tch kombinac je tolik!)
Darkelf2.4.2003 (14:52)
Fanda: Draco europeanus.....hezk popis wverna.
Fanda2.4.2003 (14:56)
Argonantus:
- Z ist vlasteneckho hlediska klidn
- pobe jsem myslm rozebral dost a obecn si myslm, e je to jedno z monch psobi
- severovchodn bainou mysl co? Finsko? Jak u jsem psal - v bainch asi jen pozemn formy. Jinak pokud jde o vskyt plaz na severu - zmije obecn a jetrka ivorod jdou a za polrn kruh a asi nebude nhoda, e jsou to ivorod druhy (mon jen vejcoivorod - pesn nevm - musel bych se juknout do njak moudr knihy).
- ani a nebezk drak - pokud mysl jako "mytologick stvoen", ekl bych, e asi ano, kdy u ho maj i Japonci, a pokud mysl jako souhvzd, tak bych ekl, e urit, kdy je to soust jejich zvrokruhu - ale vce o Vchodnch dracch, a si najdu as znovu skouknout ty Legendy drach csa, co se mi vl doma na polici.

A pokud jde o zaloen Drak II - tedy nech posledn pspvek zde je zakladatelv vcuc toho nejpodstatnjho.
argonantus2.4.2003 (15:08)
Darkelf:
ty jsi maniak, s tma esti nohama. Tob se zkrtka lp lb tyi noiky a kdla... jsi skuten obt novodob fantasy...

ale zkus na chvli pipustit, e nejde jen o noiky; e chyba je v celkovm tlesnm TVARU toho zvete...

me mt funkn tvar vysloven podlouhl (had, krokodl) - ale ten prost nen k ltn; jen v malch rozmrech lze vymyslet takov kompromis, jako Draco volans...

nebo me mt funknho ltacho jetra, ale ten vypad PLN JINAK, ne krokodl s kdly... a een nen ani Tyrannosaurus s kdly (s touhle pedstavou v hlav jsem se dost potkal, kdy jsem vytvel Nigreona...), protoe by to bylo pern tk monstrum, a ta kdla by pak vyla pln zbsile obrovsk (kdov, jestli by ltajcmu karnosaurovi tch ticet metr stailo).
Ptakojeti maj posunut noiky hodn dol, a pohybuj se vzpmen, jako ptci (pokud se po zemi vbec pohybuj - asi nic moc). Rozhodn je pro n nepirozen leet na bie jako krokodl. K emu jsou pak dobr ty noiky nahoe??

Co se te ppadnch manipulac s koist (a s prsteny, knihami apod.) - to em tmi drpy na kdlech, kter ptakojeti skuten mli (a m je souasn mld ptka hoacina, take se um chytat kdly vtv), kter vypadaj pole mne dost efektn, (navc je mon, e drpem lze probodnout srdce koisti, jak in Nigreon - tohle je, bude se divit, vypjen od toho Kongamata)
samozejm, i ptakojetr me mt dost dlouh ocas(s kormidlem, jako Ramphorynchus), ba i dlouh krk - ale to na celkovm ptkovitm tvaru tla u nic nemn...
Darkelf2.4.2003 (15:14)
Argonantus: (hej rychle zalo draky)
A vy zasse vichni povaujete draka za kuss jetho massa, m sse ztrc jeho moudrosst. Zapomnte na jeho magii a jeho zrunosst. Co kdy prosst na nco voln pedn konetiny potebuje?!
Jinak tvj pohled odkazuji na amby: Tm je taky divn, pro m ruky, kdy ssi vlasstn me vechno obalit tlem?!
argonantus2.4.2003 (15:20)
Draky II zalom, a provedu ten vcuc, kter m smysl jen v tom novm fru...
- dnes u tady meme - ba co dm - musme - vydret...
elder2.4.2003 (16:06)
Konene mm trochu asu, tak sa tie vyjadrm k tm biotopom. V nieom budem mono opakova to o u bolo napsan Fandom alebo Argonantom.

Najskr ako si draka predstavujem:
Plaz, endotermne homoiotermn (predpokladm, e je jednm z vrcholnch evolunch stupov plazov a u tak krokodl m k teplokrvnosti blzko, ako to bolo u dinosaurov nechm na paleontolgov). Aktvne lietajci. Vekos rzna - od 1,5m po max. 15m (s chvostom) - zvis od ivotnho prostredia - biotopu.

Potajme teraz z obdobm do stredoveku, vrtane (mono posledn vskyt drakov v Eurpe).
Zkladom je vekos potravinovovej zkladne. Preto som skeptick k vskytu vch foriem v Eurpskych horch. Tie by vieho draka (nad 3 m) neuivili v iadnom prpade. Kee predpokladom je teplokrvnos, nemono pota s vlastnosou plazov vydra dlh obdobie bez potravy v aktvnejom stave (maximlne prav alebo neprav hiberncia). A teda situcia, e raz sa nadlbne zdochln kamzkov a kozorocov zmetench lavnou a potom m mesiac dietu nepripad do vahy. Pravideln strava je potrebn a jej mnostvo zvis na vekosti.
Lov v priahlch podhorskch lesoch, na potravu bohatch, je takisto pre vie formy nemysliten pre Fandom spomnan riziko zranenia (pre porovnanie - aj minimlne zranenie pre drav vtky me ma fatlne nsledky. Predpokladajme, e drak m takisto ako vtky, odahen kosti. o s nimi me spravi nhodn nraz do stromu?) Preto do lesov a respektve dungl (lovec opc), mono umiestni len tie najmenie formy. A lov hospodrskych zvierat = nespokojnos sedliakov = hrdina drakobijca (cel tlupa :-)) = mtvy drak (a vina tlupy drakobijcov :-)) = vskyt draka len v kronikch.
Z toho vyplva: Hory pre mnostvo potencilnych krytov a hniezdisk (jaskyne krasovch oblast) a relatvnu nedostupnos mohli pre vie formy maximlne sli ako hniezdny biotop. Za potravou museli inde ale zas nie cez cel kontinent. Tam kde s otvorenejie priestory. Lesostepy a stepi (savany, prrie). Ako idelne lovisko najvch drakov si predstavujem americk great plains pred prchodom eurpanov (a anov :-)). Z takho bizna sa mohol drak nara poriadne. A vekos pvodnch biznch std je povestn, take by sa uivilo dostaton mnostvo drakov (na vzlet z rovnej plne je potrebn ten aktvny let, mono z rozbehom - chvatn predstava:-)). A Skalist hory na kryt s nealeko. Parda! Dra raj! Preo prve odtia s znme skr hromov vtky? Kompetcia? :-)
To o o americkch prrijch plat aj pre africk savany a zijsk stepi ale aj tundru (seznne sobie stda, ale zrejme menia vekos drakov).

Otvoren priestor + dostatok potravy + horsk kryty nealeko = vek draci.

al vek draci sa mohli vyskytova na tch pobreiach mor a ocenov. pecializcia - ryboravos. Mono vedeli aj plva (vodn draci, morsk hady). Starovek a stredovek rybrske techniky populcie rb skoro vbec neohrozovali a zneistenie nebolo takmer nijakm problmom. Morskch drakov mohlo vyhubi prve drancovanie mor a "ropn kvrny" v novoveku. Pobren tesy bvaj asto prederaven jaskyami, take kryt mme tie.

Moarist biotopy. Asi naozaj len tie nelietav formy a menie. Tej potravy tam na vek obludy nie je a toko (viac vtctva ako vekch cicavcov). Alebo aspo vemi riedky vskyt drakov. Ale potom vyvstva problm s rozmnoovanm. A riziko zvyuje kad zmenenie populcie. Trochu by to rieila dlhovekos drakov ale nie dokonale. Mono preto ich u tak dlho nikto nevidel :-).

No, mono trohu zmetene, ale sn k veci :-).
Fanda2.4.2003 (17:35)
Elder:
Kolego, rd bych V skvl pspvek doplnil.
Ideln by pro draky byl tedy i Kavkaz, pop. Ural - do velkch ruskch step to tam tak nen daleko. Nutno tak podotknout, e dve bvalo v Evrop vce kus zve ne nyn a to i t velk - nap. takov zubr - ale je pravda, e to je zve spe lesn narozdl od svho americkho bratrnka.
Pokud jde o problm rozmnoovn - mohla by to eit partenogeneze, kter je u nkterch jetrek a had doloen - ve by to pak byly draice.

Argonantus:
Dle nkterch rekonstrukc mohli, alespo primitivnj pterosaui, celkem ile pobhat.

Darkelf:
Nejradi mm lidi, kte kdy nemu nerozum, automaticky pedpokldj, e tomu nerozum nikdo.
J jsem tvernoec a estinohost mouchy, jakoto lenovce, mi divn nepijde. estinohost draka, jakoto obratlovce, divn je.
Krom toho problmu s Hox-geny, kter jsem rozebral u na zatku a kter maj opravdu fatln vliv na stavbu tla, je tu mon dedukn pohled evolun (a geny k tomu potebovat nebudu) - vem si to takhle:
Drak je bezesporu obratlovec a m est pr konetin.
Vichni ostatn obratlovci maj 2 pry konetin, nkte mn.
Z toho vyplv, e pvodn stav (a d se doloit teba embriologicky) je mt dva pry konetin.
U Tvho draka (Draco darkelfii) by muselo dojt ke zdvojen jednoho pru konetin - dle kreseb zd se, e prvnho.
Pravdpodobn by to muselo bt ve stdiu, kdy pvodn pedn konetiny mly tvar kriv nohy, tud duplifikac tohoto pru by vznikly dva pry krivch konetin v pedn sti tla.
Nyn by se mohlo zdt, e jeden z pr by byl k nepoteb a mohl by se tedy vyvinout (akoli jak selekn tlak by k tomu vedl, nevm) v kdla (pravdpodobn by spe zdegradoval).
JENE mt o jeden pr nohou navc, to je drah sranda - za vechno se plat a zde energie, kterou tento neboh jedinec vrazil do jednoho pru nohou by mohla bt vyuita jinak - do rstu, nebo do rozmnoovn. Navc ne by se tak stalo, obvm se, e by se mu ty noiky vepedu pletly.
A jeliko evoluce je slep a neplnuje a vdy mus pracovat s tm, co m po ruce, tak velmi vzdlen vyhldka na takovou evolun vhodu, jakou by asi let u takovchto drak byl, bude pemznuta okamitou vhodou rychleji se mnocch a obratnjch tvernohch drak.

Nco jinho je, pokud do toho bude mchat magii - ta s evoluc nem spolenho nic a tak takov draci mohou bt estinoz.
darkelf3.4.2003 (9:13)
Fanda:
A co lalokoploutv ryby?! Tam nelze mluvit o tyech konetninch (pokud vezme v vahu ssvalnatou a pohybujc sse hbetn ploutev). Pokud nara na ty obratle.
Tahle energie vloen do dalch konetin nen vubec marn, jenom posslit metabolissmuss.
- Ty tvoje Hoxgeny maj letln vliv na uritou ssekvenci. Jenome pokud sse ssekvence mn, mn sse tak jeho vliv a vliv jejich mutac. K tomu nepotm taky k vyuit njakho zbytkovho intronu pro tyhle geny. (lze jet podotknout, e je docela mon, e to tak nemuss bt esst konetina, ale pouze prsst)
Evoluce je tak nerovnomrn (a to u nkdo propotal...a je z toho jedna ze zhad...nco o tom, e kad hmota je do urit mry njak naprogramovan...ale to jinam)
(kdy maj obratlovci mn konetin ne dv, nen ssnad nemon aby mli esst....jinak ssi te vzpomnm na esstinoh kachny, no jo, oni toti peij, ssice nohy maj minimln sschopnossti, ale assem)
A co takhle ocass, dal konetina a u nkterch tvor dokonale chpav.
- Nen embrio jako embrio.

- a nebo je to duplikac krdel blanitch, e? Proto povauji Wyverny jako pbuzn drakm. Anakonec sse taky utp v pravdpodobnossti, take ssm nev!
(drah pss to je, draci sse njak extrmn nerozmnouj a rosstou nkolik tissc let). Pletly a jak prossm t?

Vhoda??? V vbec ty, co udlali chpav ruce z lid???? a mt k tomu jet kdla....mno jak vhoda. Wyvern je prakticky nepouiteln (krom hor). protoe pokud nechytne nco v letu a v letu to neuchvt, kon na zemi, co je docela problm. Vrhn jedu je pak naprosstou zbytenosst. Mj ssi ssvho sskkajcho kanra, j mm ssvoje draky.

Magie a evoluce maj co do ssebe!
darkelf3.4.2003 (9:20)
Fanda: J to dn na Draky II, tak tam i odpovdej.
argonantus3.4.2003 (9:20)
Hle! Upozouji, e Draci II ji existuj!


Bude ovem nutno penst vae nejdleitj mylenky, kter jsem vynechal v Summ, a ppadn ty, kter doly po uzvrce...
Argonantus12.6.2003 (11:23)
Tohle jen tak pro podek - chci mt tohle frum po ruce.

Nepite sem - pokud nco chcete, dejte to na Draky II!
Darkelf18.6.2003 (11:19)
Sem vbec nepu :-)
S.U.P.8.7.2003 (12:57)
ja taky ne..
argonantus21.10.2003 (13:10)
drba!
J sem taky nepu!
Argonantus5.1.2004 (8:37)
Nepu sem; ale ono je tolik novch tmat... e to co chvli zapadne.
Jerson27.8.2004 (11:33)
Tahm toto tma nahoru, aby bylo pohromad s ostatnma. Neteba sem cokoliv pst, od toho jsou Draci IV (a v budoucnu mon pokraovn).
Argonantus17.11.2005 (17:00)
tak polezte, draci... pokolikt u...
Argonatus4.5.2006 (8:55)
...